beta V Tubulin (TUBB) (NM_178014) Human Untagged Clone

CAT#: SC319277

Reviews ()
Write a review

TUBB (untagged)-Human tubulin, beta (TUBB)



  "NM_178014" in other vectors (6)

Reconstitution Protocol

USD 457.00


Availability*
In Stock

Size
    • 10 ug


Product images

Other products for "TUBB"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TUBB
Synonyms CDCBM6; CSCSC1; M40; OK/SW-cl.56; TUBB1; TUBB5
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_178014.2 GCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAACCTTCCAGCCTGCGACCTGCGGAG
AAAAAAAATTACTTATTTTCTTGCCCCATACATACCTTGAGGCGAGCAAAAAAATTAAAT
TTTAACCATGAGGGAAATCGTGCACATCCAGGCTGGTCAGTGTGGCAACCAGATCGGTGC
CAAGTTCTGGGAGGTGATCAGTGATGAACATGGCATCGACCCCACCGGCACCTACCACGG
GGACAGCGACCTGCAGCTGGACCGCATCTCTGTGTACTACAATGAAGCCACAGGTGGCAA
ATATGTTCCTCGTGCCATCCTGGTGGATCTAGAACCTGGGACCATGGACTCTGTTCGCTC
AGGTCCTTTTGGCCAGATCTTTAGACCAGACAACTTTGTATTTGGTCAGTCTGGGGCAGG
TAACAACTGGGCCAAAGGCCACTACACAGAGGGCGCCGAGCTGGTTGATTCTGTCCTGGA
TGTGGTACGGAAGGAGGCAGAGAGCTGTGACTGCCTGCAGGGCTTCCAGCTGACCCACTC
ACTGGGCGGGGGCACAGGCTCTGGAATGGGCACTCTCCTTATCAGCAAGATCCGAGAAGA
ATACCCTGATCGCATCATGAATACCTTCAGTGTGGTGCCTTCACCCAAAGTGTCTGACAC
CGTGGTCGAGCCCTACAATGCCACCCTCTCCGTCCATCAGTTGGTAGAGAATACTGATGA
GACCTATTGCATTGACAACGAGGCCCTCTATGATATCTGCTTCCGCACTCTGAAGCTGAC
CACACCAACCTACGGGGATCTGAACCACCTTGTCTCAGCCACCATGAGTGGTGTCACCAC
CTGCCTCCGTTTCCCTGGCCAGCTCAATGCTGACCTCCGCAAGTTGGCAGTCAACATGGT
CCCCTTCCCACGTCTCCATTTCTTTATGCCTGGCTTTGCCCCTCTCACCAGCCGTGGAAG
CCAGCAGTATCGAGCTCTCACAGTGCCGGAACTCACCCAGCAGGTCTTCGATGCCAAGAA
CATGATGGCTGCCTGTGACCCCCGCCACGGCCGATACCTCACCGTGGCTGCTGTCTTCCG
TGGTCGGATGTCCATGAAGGAGGTCGATGAGCAGATGCTTAACGTGCAGAACAAGAACAG
CAGCTACTTTGTGGAATGGATCCCCAACAATGTCAAGACAGCCGTCTGTGACATCCCACC
TCGTGGCCTCAAGATGGCAGTCACCTTCATTGGCAATAGCACAGCCATCCAGGAGCTCTT
CAAGCGCATCTCGGAGCAGTTCACTGCCATGTTCCGCCGGAAGGCCTTCCTCCACTGGTA
CACAGGCGAGGGCATGGACGAGATGGAGTTCACCGAGGCTGAGAGCAACATGAACGACCT
CGTCTCTGAGTATCAGCAGTACCAGGATGCCACCGCAGAAGAGGAGGAGGATTTCGGTGA
GGAGGCCGAAGAGGAGGCCTAAGGCAGAGCCCCCATCACCTCAGGCTTCTCAGTTCCCTT
AGCCGTCTTACTCAACTGCCCCTTTCCTCTCCCTCAGAATTTGTGTTTGCTGCCTCTATC
TTGTTTTTTGTTTTTTCTTCTGGGGGGGGTCTAGAACAGTGCCTGGCACATAGTAGGCGC
TCAATAAATACTTGTTTGTTGAATGTCTCCTCTCTCTTTCCACTCTGGGAAACCTAGGTT
TCTGCCATTCTGGGTGACCCTGTATTTCTTTCTGGTGCCCATTCCATTTGTCCAGTTAAT
ACTTCCTCTTAAAAATCTCCAAGAAGCTGGGTCTCCAGATCCCATTTAGAACCAACCAGG
TGCTGAAAACACATGTAGATAATGGCCATCATCCTAAGCCCAAAGTAGAAAATGGTAGAA
GGTAGTGGGTAGAAGTCACTATATAAGGAAGGGGATGGGATTTTCCATTCTAAAAGTTTT
GGAGAGGGAAATCCAGGCTATTAAAGTCACTAAATTTCTAAGTATGTCCATTTCCCATCT
CAGCTTCAAGGGAGGTGTCAGCAGTATTATCTCCACTTTCAATCTCCCTCCAAGCTCTAC
TCTGGAGGAGTCTGTCCCACTCTGTCAAGTGGAATCCTTCCCTTTCCAACTCTACCTCCC
TCACTCAGCTCCTTTCCCCTGATCAGAGAAAGGGATCAAGGGGGTTGGGAGGGGGGAAAG
AGACCAGCCTTGGTCCCTAAGCCTCCAGAAACGTCTTCTTAATCCCCACCTTTTCTTACT
CCCAAAAAAGAATGAACACCCCTGACTCTGGAGTGGTGTATACTGCCACATCAGTGTTTG
AGTCAGTCCCCAGAGGAGAGGGGAACCCTCCTCCATCTTTTTTGCAACATCTCATTTCTT
CCTTTTGCTGTTGCTTCCCCCCTCACACACTTGGTTTTGTTCTATCCTACATTTGAGATT
TCTATTTTATGTTGAACTTGCTGCTTTTTTTCATATTGAAAAGATGACATCGCCCCAAGA
GCCAAAAATAAATGGGAATTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_178014
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_178014.2, NP_821133.1
RefSeq Size 2510 bp
RefSeq ORF 1335 bp
Locus ID 203068
UniProt ID P07437
Cytogenetics 6p21.33
Protein Families Druggable Genome
Protein Pathways Gap junction, Pathogenic Escherichia coli infection
Gene Summary This gene encodes a beta tubulin protein. This protein forms a dimer with alpha tubulin and acts as a structural component of microtubules. Mutations in this gene cause cortical dysplasia, complex, with other brain malformations 6. Alternative splicing results in multiple splice variants. There are multiple pseudogenes for this gene on chromosomes 1, 6, 7, 8, 9, and 13. [provided by RefSeq, Jun 2014]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (b) has a distinct N-terminus and is shorter than isoform a.

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.