IVD (NM_002225) Human Untagged Clone

SKU
SC319252
IVD (untagged)-Human isovaleryl-CoA dehydrogenase (IVD), nuclear gene encoding mitochondrial protein, transcript variant 1
$686.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol IVD
Synonyms ACAD2; IVDH
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002225.2 GCATGGCAGAGATGGCGACTGCGACTCGGCTGCTGGGGTGTCGTGTGGCGAGCTGGAGGC
TGCGGCCGCCGCTTGCCGGCTTCGTTTCCCAGCGGGCCCACTCGCTTTTGCCCGTGGACG
ATGCAATCAATGGGCTAAGCGAGGAGCAGAGGCAGCTTCGTCAGACCATGGCTAAGTTCC
TTCAGGAGCACCTGGCCCCCAAGGCCCAGGAGATCGATCGCAGCAATGAGTTCAAGAACC
TGCGAGAATTTTGGAAGCAGCTGGGGAACCTGGGCGTATTGGGCATCACAGCCCCTGTTC
AGTATGGCGGCTCCGGCCTGGGCTACCTGGAGCATGTGCTGGTGATGGAGGAGATATCCC
GAGCTTCCGGAGCAGTGGGGCTCAGTTACGGTGCCCACTCCAACCTCTGCATCAACCAGC
TTGTACGCAATGGGAATGAGGCCCAGAAAGAGAAGTATCTCCCGAAGCTGATCAGTGGTG
AGTACATCGGAGCCCTGGCCATGAGTGAGCCCAATGCAGGCTCTGATGTTGTCTCTATGA
AGCTCAAAGCGGAAAAGAAAGGAAATCACTACATCCTGAATGGCAACAAGTTCTGGATCA
CTAATGGCCCTGATGCTGACGTCCTGATTGTCTATGCCAAGACAGATCTGGCTGCTGTGC
CAGCTTCTCGGGGCATCACAGCCTTCATTGTGGAGAAGGGTATGCCTGGCTTTAGCACCT
CTAAGAAGCTGGACAAGCTGGGGATGAGGGGCTCTAACACCTGTGAGCTAATCTTTGAAG
ACTGCAAGATTCCTGCTGCCAACATCCTGGGCCATGAGAATAAGGGTGTCTACGTGCTGA
TGAGTGGGCTGGACCTGGAGCGGCTGGTGCTGGCCGGGGGGCCTCTTGGGCTCATGCAAG
CGGTCCTGGACCACACCATTCCCTACCTGCACGTGAGGGAAGCCTTTGGCCAGAAGATCG
GCCACTTCCAGTTGATGCAGGGGAAGATGGCTGACATGTACACCCGCCTCATGGCGTGTC
GGCAGTATGTCTACAATGTCGCCAAGGCCTGCGATGAGGGCCATTGCACTGCTAAGGACT
GTGCAGGTGTGATTCTTTACTCAGCTGAGTGTGCCACACAGGTAGCCCTGGACGGCATTC
AGTGTTTTGGTGGCAATGGCTACATCAATGACTTTCCCATGGGCCGCTTTCTTCGAGATG
CCAAGCTGTATGAGATAGGGGCTGGGACCAGCGAGGTGAGGCGGCTGGTCATCGGCAGAG
CCTTCAATGCAGACTTTCACTAGTCCTGAGACCCTTCGCCCCCTTTTCCTGCACCTAGTG
GCCTTTCTTGGGAAGTAGAGATGTGGCGGCTTTCCCACCCTGCCCACAGCAGGCCCTCCT
GCCCAGCTGCTCTTGTCAGCCCTCTGGCCTCTGGATGAGGTTGAGTTCTCCACAACAGCT
CCCAAGCATCATGGGCCTCGCAGCCGGGCCTGTGCCACGGCTAGTGTTGTGTGATTTAAA
ATGGACTCAGCAGGAAGCATATTGTCTGGGGATTGTTGGGACAAGTTTTGGTGACTCTGT
GCCCTTGCTCTCTAACTTCTGAGCCCACCTCCCAGGGTAGGCACCTGGGGGCATGCAGGT
GCCCACCTCCCAGGGTAGGCACCTGGGGGCATGCAGGTACCCACCTCTTTCTCTTGGGTG
AGGCTCTGGCAAGGAGATCTCTCTGCTCAAGCACAGCAGAATCATGGCCCCTCTCCATGA
ATTGGAACTTGGTACAGGTTAAGTATCCCTAATCCTGAAATCTGAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_002225
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002225.2, NP_002216.1
RefSeq Size 4673 bp
RefSeq ORF 1272 bp
Locus ID 3712
UniProt ID P26440
Cytogenetics 15q15.1
Domains Acyl-CoA_dh, Acyl-CoA_dh_M, Acyl-CoA_dh_N
Protein Families Druggable Genome
Protein Pathways leucine and isoleucine degradation, Metabolic pathways, Valine
Summary Isovaleryl-CoA dehydrogenase (IVD) is a mitochondrial matrix enzyme that catalyzes the third step in leucine catabolism. The genetic deficiency of IVD results in an accumulation of isovaleric acid, which is toxic to the central nervous system and leads to isovaleric acidemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2017]
Transcript Variant: This variant (1) represents the predominant transcript, and encodes isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: The coding region has been updated to shorten the N-terminus to one that is more supported by conservation.
Write Your Own Review
You're reviewing:IVD (NM_002225) Human Untagged Clone
Your Rating
SKU Description Size Price
RC201077 IVD (Myc-DDK-tagged)-Human isovaleryl-CoA dehydrogenase (IVD), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$686.00
RC201077L1 Lenti ORF clone of Human isovaleryl-CoA dehydrogenase (IVD), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged 10 ug
$986.00
RC201077L2 Lenti ORF clone of Human isovaleryl-CoA dehydrogenase (IVD), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged 10 ug
$986.00
RC201077L3 Lenti ORF clone of Human isovaleryl-CoA dehydrogenase (IVD), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged 10 ug
$986.00
RC201077L4 Lenti ORF clone of Human isovaleryl-CoA dehydrogenase (IVD), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged 10 ug
$986.00
RC229217 IVD (Myc-DDK-tagged)-Human isovaleryl-CoA dehydrogenase (IVD), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$686.00
RC229217L1 Lenti ORF clone of Human isovaleryl-CoA dehydrogenase (IVD), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged 10 ug
$986.00
RC229217L2 Lenti ORF clone of Human isovaleryl-CoA dehydrogenase (IVD), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged 10 ug
$986.00
RC229217L3 Lenti ORF clone of Human isovaleryl-CoA dehydrogenase (IVD), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged 10 ug
$986.00
RC229217L4 Lenti ORF clone of Human isovaleryl-CoA dehydrogenase (IVD), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged 10 ug
$986.00
RG201077 IVD (tGFP-tagged) - Human isovaleryl-CoA dehydrogenase (IVD), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$886.00
RG229217 IVD (tGFP-tagged) - Human isovaleryl-CoA dehydrogenase (IVD), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$886.00
SC327852 IVD (untagged)-Human isovaleryl Coenzyme A dehydrogenase (IVD) nuclear gene encoding mitochondrial protein transcript variant 1 10 ug
$732.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.