IDH2 (NM_002168) Human Untagged Clone

CAT#: SC319226

IDH2 (untagged)-Human isocitrate dehydrogenase 2 (NADP+), mitochondrial (IDH2), nuclear gene encoding mitochondrial protein

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name IDH2 (NM_002168) Human Untagged Clone
Symbol IDH2
Synonyms D2HGA2; ICD-M; IDH; IDHM; IDP; IDPM; mNADP-IDH
Vector pCMV6-AC
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002168.2 GGCAGCCGGGAGGAGCGGCGCGCGCTCGGACCTCTCCCGCCCTGCTCGTTCGCTCTCCAG
CTTGGGATGGCCGGCTACCTGCGGGTCGTGCGCTCGCTCTGCAGAGCCTCAGGCTCGCGG
CCGGCCTGGGCGCCGGCGGCCCTGACAGCCCCCACCTCGCAAGAGCAGCCGCGGCGCCAC
TATGCCGACAAAAGGATCAAGGTGGCGAAGCCCGTGGTGGAGATGGATGGTGATGAGATG
ACCCGTATTATCTGGCAGTTCATCAAGGAGAAGCTCATCCTGCCCCACGTGGACATCCAG
CTAAAGTATTTTGACCTCGGGCTCCCAAACCGTGACCAGACTGATGACCAGGTCACCATT
GACTCTGCACTGGCCACCCAGAAGTACAGTGTGGCTGTCAAGTGTGCCACCATCACCCCT
GATGAGGCCCGTGTGGAAGAGTTCAAGCTGAAGAAGATGTGGAAAAGTCCCAATGGAACT
ATCCGGAACATCCTGGGGGGGACTGTCTTCCGGGAGCCCATCATCTGCAAAAACATCCCA
CGCCTAGTCCCTGGCTGGACCAAGCCCATCACCATTGGCAGGCACGCCCATGGCGACCAG
TACAAGGCCACAGACTTTGTGGCAGACCGGGCCGGCACTTTCAAAATGGTCTTCACCCCA
AAAGATGGCAGTGGTGTCAAGGAGTGGGAAGTGTACAACTTCCCCGCAGGCGGCGTGGGC
ATGGGCATGTACAACACCGACGAGTCCATCTCAGGTTTTGCGCACAGCTGCTTCCAGTAT
GCCATCCAGAAGAAATGGCCGCTGTACATGAGCACCAAGAACACCATACTGAAAGCCTAC
GATGGGCGTTTCAAGGACATCTTCCAGGAGATCTTTGACAAGCACTATAAGACCGACTTC
GACAAGAATAAGATCTGGTATGAGCACCGGCTCATTGATGACATGGTGGCTCAGGTCCTC
AAGTCTTCGGGTGGCTTTGTGTGGGCCTGCAAGAACTATGACGGAGATGTGCAGTCAGAC
ATCCTGGCCCAGGGCTTTGGCTCCCTTGGCCTGATGACGTCCGTCCTGGTCTGCCCTGAT
GGGAAGACGATTGAGGCTGAGGCCGCTCATGGGACCGTCACCCGCCACTATCGGGAGCAC
CAGAAGGGCCGGCCCACCAGCACCAACCCCATCGCCAGCATCTTTGCCTGGACACGTGGC
CTGGAGCACCGGGGGAAGCTGGATGGGAACCAAGACCTCATCAGGTTTGCCCAGATGCTG
GAGAAGGTGTGCGTGGAGACGGTGGAGAGTGGAGCCATGACCAAGGACCTGGCGGGCTGC
ATTCACGGCCTCAGCAATGTGAAGCTGAACGAGCACTTCCTGAACACCACGGACTTCCTC
GACACCATCAAGAGCAACCTGGACAGAGCCCTGGGCAGGCAGTAGGGGGAGGCGCCACCC
ATGGCTGCAGTGGAGGGGCCAGGGCTGAGCCGGCGGGTCCTCCTGAGCGCGGCAGAGGGT
GAGCCTCACAGCCCCTCTCTGGAGGCCTTTCTAGGGGATGTTTTTTTATAAGCCAGATGT
TTTTAAAAGCATATGTGTGTTTCCCCTCATGGTGACGTGAGGCAGGAGCAGTGCGTTTTA
CCTCAGCCAGTCAGTATGTTTTGCATACTGTAATTTATATTGCCCTTGGAACACATGGTG
CCATATTTAGCTACTAAAAAGCTCTTCACAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002168.2 unedited
GACCATTGTATACGACTCCTATAGGGCGGCCGGGTAATTCGGCACGAGGGGCAGCCGGGA
GGAGCGGCGCGCGCTCGGACCTCTCCCGCCCTGCTCGTTCGCTCTCCAGCTTGGGATGGC
CGGCTACCTGCGGGTCGTGCGCTCGCTCTGCAGAGCCTCAGGCTCGCGGCCGGCCTGGGC
GCCGGCGGCCCTGACAGCCCCCACCTCGCAAGAGCAGCCGCGGCGCCACTATGCCGACAA
AAGGATCAAGGTGGCGAAGCCCGTGGTGGAGATGGATGGTGATGAGATGACCCGTATTAT
CTGGCAGTTCATCAAGGAGAAGCTCATCCTGCCCCACGTGGACATCCAGCTAAAGTATTT
TGACCTCGGGCTCCCAAACCGTGACCAGACTGATGACCAGGTCACCATTGACTCTGCACT
GGCCACCCAGAAGTACAGTGTGGCTGTCAAGTGTGCCACCATCACCCCTGATGAGGCCCG
TGTGGAAGAGTTCAAGCTGAAGAAGATGTGGAAAAGTCCCAATGGAACTATCCGGAACAT
CCTGGGGGGGACTGTCTTCCGGGAGCCCATCATCTGCAAAAACATCCCACGCCTAGTCCC
TGGCTGGACCAAGCCCATCACCATTGGCAGGCACGCCCATGGCGACCAGTACAAGGCCAC
AGACTTTGTGGCAGACCGGGCCGGCACTTTCAAAATGGTCTTCACCCCAAAAGATGGCAG
TGGTGTCAAGGAGTGGGAAGTGTACAACTTTCCCCGCAGGCGGCGTGGGCATGGGCATGT
ACAACACCGACGAGTCCATCTCAGGTTTTGCGCACAGCTGCTTCCAGTATGCCCATCCAG
AGAAATGGCCGCTGTAACATGAGCCACCAGACACCATACTGAAGCTACGATGGGGCGTTC
CAGACATCCTCAGGAGATTCTTGGACAGACACTATAGGACCGGACTCGACAGGATAGATT
CTTGGTTATGGAGC
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_002168
ORF Size 1359 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002168.2, NP_002159
RefSeq Size 1740
RefSeq ORF 1359
Locus ID 3418
Cytogenetics 15q26.1
Domains isodh
Protein Pathways Citrate cycle (TCA cycle), Glutathione metabolism, Metabolic pathways
Gene Summary Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. Each NADP(+)-dependent isozyme is a homodimer. The protein encoded by this gene is the NADP(+)-dependent isocitrate dehydrogenase found in the mitochondria. It plays a role in intermediary metabolism and energy production. This protein may tightly associate or interact with the pyruvate dehydrogenase complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014].
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations