Inhibin beta A(INHBA) (NM_002192) Human Untagged Clone

CAT#: SC319183

INHBA (untagged)-Human inhibin, beta A (INHBA)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Inhibin beta A(INHBA) (NM_002192) Human Untagged Clone
Symbol INHBA
Synonyms EDF; FRP
Vector pCMV6-AC
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002192.2 CATGAAGAGGAGCTCAGACAGCTCTTACCACATGATACAAGAGCCGGCTGGTGGAAGAGT
GGGGACCAGAAAGAGAATTTGCTGAAGAGGAGAAGGAAAAAAAAAAACACCAAAAAAAAA
AATAAAAAAATCCACACACACAAAAAAACCTGCGCGTGAGGGGGGAGGAAAAGCAGGGCC
TTTTAAAAAGGCAATCACAACAACTTTTGCTGCCAGGATGCCCTTGCTTTGGCTGAGAGG
ATTTCTGTTGGCAAGTTGCTGGATTATAGTGAGGAGTTCCCCCACCCCAGGATCCGAGGG
GCACAGCGCGGCCCCCGACTGTCCGTCCTGTGCGCTGGCCGCCCTCCCAAAGGATGTACC
CAACTCTCAGCCAGAGATGGTGGAGGCCGTCAAGAAGCACATTTTAAACATGCTGCACTT
GAAGAAGAGACCCGATGTCACCCAGCCGGTACCCAAGGCGGCGCTTCTGAACGCGATCAG
AAAGCTTCATGTGGGCAAAGTCGGGGAGAACGGGTATGTGGAGATAGAGGATGACATTGG
AAGGAGGGCAGAAATGAATGAACTTATGGAGCAGACCTCGGAGATCATCACGTTTGCCGA
GTCAGGAACAGCCAGGAAGACGCTGCACTTCGAGATTTCCAAGGAAGGCAGTGACCTGTC
AGTGGTGGAGCGTGCAGAAGTCTGGCTCTTCCTAAAAGTCCCCAAGGCCAACAGGACCAG
GACCAAAGTCACCATCCGCCTCTTCCAGCAGCAGAAGCACCCGCAGGGCAGCTTGGACAC
AGGGGAAGAGGCCGAGGAAGTGGGCTTAAAGGGGGAGAGGAGTGAACTGTTGCTCTCTGA
AAAAGTAGTAGACGCTCGGAAGAGCACCTGGCATGTCTTCCCTGTCTCCAGCAGCATCCA
GCGGTTGCTGGACCAGGGCAAGAGCTCCCTGGACGTTCGGATTGCCTGTGAGCAGTGCCA
GGAGAGTGGCGCCAGCTTGGTTCTCCTGGGCAAGAAGAAGAAGAAAGAAGAGGAGGGGGA
AGGGAAAAAGAAGGGCGGAGGTGAAGGTGGGGCAGGAGCAGATGAGGAAAAGGAGCAGTC
GCACAGACCTTTCCTCATGCTGCAGGCCCGGCAGTCTGAAGACCACCCTCATCGCCGGCG
TCGGCGGGGCTTGGAGTGTGATGGCAAGGTCAACATCTGCTGTAAGAAACAGTTCTTTGT
CAGTTTCAAGGACATCGGCTGGAATGACTGGATCATTGCTCCCTCTGGCTATCATGCCAA
CTACTGCGAGGGTGAGTGCCCGAGCCATATAGCAGGCACGTCCGGGTCCTCACTGTCCTT
CCACTCAACAGTCATCAACCACTACCGCATGCGGGGCCATAGCCCCTTTGCCAACCTCAA
ATCGTGCTGTGTGCCCACCAAGCTGAGACCCATGTCCATGTTGTACTATGATGATGGTCA
AAACATCATCAAAAAGGACATTCAGAACATGATCGTGGAGGAGTGTGGGTGCTCATAGAG
TTGCCCAGCCCAGGGGGAAAGGGAGCAAGAGTTGTCCAGAGAAGACAGTGGCAAAATGAA
GAAATTTTTAAGGTTTCTGAGTTAACCAGAAAAATAGAAATTAAAAACAAAACAAAAAAA
AAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002192.2 unedited
GACTATATGTTATACGACTCCTATAGGGCGGCCGGGAATTCGGCACGAGGCATGAAGAGG
AGCTCAGACAGCTCTTACCACATGATACAAGAGCCGGCTGGTGGAAGAGTGGGGACCAGA
AAGAGAATTTGCTGAAGAGGAGAAGGAAAAAAAAAAACACCAAAAAAAAAAATAAAAAAA
TCCACACACACAAAAAAACCTGCGCGTGAGGGGGGAGGAAAAGCAGGGCCTTTTAAAAAG
GCAATCACAACAACTTTTGCTGCCAGGATGCCCTTGCTTTGGCTGAGAGGATTTCTGTTG
GCAAGTTGCTGGATTATAGTGAGGAGTTCCCCCACCCCAGGATCCGAGGGGCACAGCGCG
GCCCCCGACTGTCCGTCCTGTGCGCTGGCCGCCCTCCCAAAGGATGTACCCAACTCTCAG
CCAGAGATGGTGGAGGCCGTCAAGAAGCACATTTTAAACATGCTGCACTTGAAGAAGAGA
CCCGATGTCACCCAGCCGGTACCCAAGGCGGCGCTTCTGAACGCGATCAGAAAGCTTCAT
GTGGGCAAAGTCGGGGAGAACGGGTATGTGGAGATAGAGGATGACATTGGAAGGAGGGCA
GAAATGAATGAACTTATGGAGCAGACCTCGGAGATCATCACGTTTGCCGAGTCAGGAACA
GCCAGGAAGACGCTGCACTTCGAGATTTCCAAGGAAGGCAGTGACCTGTCAGTGGTGGAG
CGTGCAGAAGTCTGGCTCTTCCTAAAAGTCCCCAAGCCCAACAGGACCAGGACCAAAGTC
ACCATCCGCTCTCAGCAGCAGAGCACCCGCAGGCAGCTGACACAGGGAGAGCCGAGGAGT
GGGCTTAAGGGGAGAGGAGGTGACTGTGCTCTTCTGAAAAGTAGTAGACGCTCGAGAGCA
CTTGCATGTCTGCAGTCCAGCAGCATTCCACGATGCTGAACAGGCCAGAGCTCCTGGGAC
GTTC
Restriction Sites -     
Tag Tag Free
ACCN NM_002192
ORF Size 1281 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002192.2, NP_002183
RefSeq Size 2175
Locus ID 3624
Cytogenetics 7p14.1
Domains TGFb_propeptide, TGF-beta
Protein Families Secreted Protein, Druggable Genome
Protein Pathways Cytokine-cytokine receptor interaction, TGF-beta signaling pathway
Gene Summary This gene encodes a member of the TGF-beta (transforming growth factor-beta) superfamily of proteins. The encoded preproprotein is proteolytically processed to generate a subunit of the dimeric activin and inhibin protein complexes. These complexes activate and inhibit, respectively, follicle stimulating hormone secretion from the pituitary gland. The encoded protein also plays a role in eye, tooth and testis development. Elevated expression of this gene may be associated with cancer cachexia in human patients. [provided by RefSeq, Aug 2016].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.