LYN (NM_001111097) Human Untagged Clone

SKU
SC318910
LYN (untagged)-Human v-yes-1 Yamaguchi sarcoma viral related oncogene homolog (LYN), transcript variant 2
$686.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol LYN
Synonyms JTK8; p53Lyn; p56Lyn
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_001111097 edited
ATGGGATGTATAAAATCAAAAGGGAAAGACAGCTTGAGTGACGATGGAGTAGATTTGAAG
ACTCAACCAGTTCCAGAATCTCAGCTTTTACCTGGACAGAGGTTTCAAACTAAAGATCCA
GAGGAACAAGGAGACATTGTGGTAGCCTTGTACCCCTATGATGGCATCCACCCGGACGAC
TTGTCTTTCAAGAAAGGAGAGAAGATGAAAGTCCTGGAGGAGCATGGAGAATGGTGGAAA
GCAAAGTCCCTTTTAACAAAAAAAGAAGGCTTCATCCCCAGCAACTATGTGGCCAAACTC
AACACCTTAGAAACAGAAGAGTGGTTTTTCAAGGATATAACCAGGAAGGACGCAGAAAGG
CAGCTTTTGGCACCAGGAAATAGCGCTGGAGCTTTCCTTATTAGAGAAAGTGAAACATTA
AAAGGAAGCTTCTCTCTGTCTGTCAGAGACTTTGACCCTGTGCATGGTGATGTTATTAAG
CACTACAAAATTAGAAGTCTGGATAATGGGGGCTATTACATCTCTCCACGAATCACTTTT
CCCTGTATCAGCGACATGATTAAACATTACCAAAAGCAGGCAGATGGCTTGTGCAGAAGA
TTGGAGAAGGCTTGTATTAGTCCCAAGCCACAGAAGCCATGGGATAAAGATGCCTGGGAG
ATCCCCCGGGAGTCCATCAAGTTGGTGAAAAGGCTTGGCGCTGGGCAGTTTGGGGAAGTC
TGGATGGGTTACTATAACAACAGTACCAAGGTGGCTGTGAAAACCCTGAAGCCAGGAACT
ATGTCTGTGCAAGCCTTCCTGGAAGAAGCCAACCTCATGAAGACCCTGCAGCATGACAAG
CTCGTGAGGCTCTACGCTGTGGTCACCAGGGAGGAGCCCATTTACATCATCACCGAGTAC
ATGGCCAAGGGCAGTTTGCTGGATTTCCTGAAGAGCGATGAAGGTGGCAAAGTGCTGCTT
CCAAAGCTCATTGACTTTTCTGCTCAGATTGCAGAGGGAATGGCATACATCGAGCGGAAG
AACTACATTCACCGGGACCTGCGAGCAGCTAATGTTCTGGTCTCCGAGTCACTCATGTGC
AAAATTGCAGATTTTGGCCTTGCTAGAGTAATTGAAGATAATGAGTACACAGCAAGGGAA
GGTGCTAAGTTCCCTATTAAGTGGACGGCTCCAGAAGCAATCAACTTTGGATGTTTCACT
ATTAAGTCTGATGTGTGGTCCTTTGGAATCCTCCTATACGAAATTGTCACCTATGGGAAA
ATTCCCTACCCAGGGAGAACTAATGCCGACGTGATGACCGCCCTGTCCCAGGGCTACAGG
ACGCCCCGTGTGGAGAACTGCCCAGATGAGCTCTATGACATTATGAAAATGTGCTGGAAA
GAAAAGGCAGAAGAGAGACCAACGTTTGACTACTTACAGAGCGTCCTGGATGATTTCTAC
ACAGCCACGGAAGGGCAATACCAGCAGCAGCCTTAG
Restriction Sites NotI-NotI
ACCN NM_001111097
Insert Size 2200 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_001111097.1.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001111097.1, NP_001104567.1
RefSeq Size 3043 bp
RefSeq ORF 1476 bp
Locus ID 4067
UniProt ID P07948
Cytogenetics 8q12.1
Protein Families Druggable Genome, Protein Kinase
Protein Pathways B cell receptor signaling pathway, Chemokine signaling pathway, Epithelial cell signaling in Helicobacter pylori infection, Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Long-term depression
Summary This gene encodes a tyrosine protein kinase, which maybe involved in the regulation of mast cell degranulation, and erythroid differentiation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
Transcript Variant: This variant (2) uses an alternate in-frame donor splice site in the 5' coding region compared to variant 1. This results in a shorter isoform (B) missing an internal protein segment compared to isoform A.
Write Your Own Review
You're reviewing:LYN (NM_001111097) Human Untagged Clone
Your Rating
SKU Description Size Price
RC225842 LYN (Myc-DDK-tagged)-Human v-yes-1 Yamaguchi sarcoma viral related oncogene homolog (LYN), transcript variant 2 10 ug
$686.00
RC225842L3 Lenti-ORF clone of LYN (Myc-DDK-tagged)-Human v-yes-1 Yamaguchi sarcoma viral related oncogene homolog (LYN), transcript variant 2 10 ug
$986.00
RC225842L4 Lenti-ORF clone of LYN (mGFP-tagged)-Human v-yes-1 Yamaguchi sarcoma viral related oncogene homolog (LYN), transcript variant 2 10 ug
$986.00
RG225842 LYN (tGFP-tagged) - Human v-yes-1 Yamaguchi sarcoma viral related oncogene homolog (LYN), transcript variant 2 10 ug
$886.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.