DARC (ACKR1) (NM_001122951) Human Untagged Clone
SKU
SC318833
DARC (untagged)-Human Duffy blood group, chemokine receptor (DARC), transcript variant 1
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | DARC |
Synonyms | CCBP1; CD234; DARC; DARC/ACKR1; Dfy; FY; GPD; GpFy; WBCQ1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_001122951 edited
ATGGCCTCCTCTGGGTATGTCCTCCAGGCGGAGCTCTCCCCCTCAACTGAGAACTCAAGT CAGCTGGACTTCGAAGATGTATGGAATTCTTCCTATGGTGTGAATGATTCCTTCCCAGAT GGAGACTATGGTGCCAACCTGGAAGCAGCTGCCCCCTGCCACTCCTGTAACCTGCTGGAT GACTCTGCACTGCCCTTCTTCATCCTCACCAGTGTCCTGGGTATCCTAGCTAGCAGCACT GTCCTCTTCATGCTTTTCAGACCTCTCTTCCGCTGGCAGCTCTGCCCTGGCTGGCCTGTC CTGGCACAGCTGGCTGTGGGCAGTGCCCTCTTCAGCATTGTGGTGCCCGTCTTGGTCCCA GGGCTAGGTAGCACTCGCAGCTCTGCCCTGTGTAGCCTGGGCTACTGTGTCTGGTATGGC TCAGCCTTTGCCCAGGCTTTGCTGCTAGGGTGCCATGCCTCCCTGGGCCACAGACTGGGT GCAGGCCAGGTCCCAGGCCTCACCCTGGGGCTCACTGTGGGAATTTGGGGAGTGGCTGCC CTACTGACACTGCCTGTCACCCTGGCCAGTGGTGCTTCTGGTGGACTCTGCACCCTGATA TACAGCACGGAGCTGAAGGCTTTGCAGGCCACACACACTGTAGCCTGTCTTGCCATCTTT GTCTTGTTGCCATTGGGTTTGTTTGGAGCCAAGGGGCTGAAGAAGGCATTGGGTATGGGG CCAGGCCCCTGGATGAACATCCTGTGGGCCTGGTTTATTTTCTGGTGGCCTCATGGGGTG GTTCTAGGACTGGATTTCCTGGTGAGGTCCAAGCTGTTGCTGTTGTCAACATGTCTGGCC CAGCAGGCTCTGGACCTGCTGCTGAACCTGGCAGAAGCCCTGGCAATTTTGCACTGTGTG GCTACGCCCCTGCTCCTCGCCCTATTCTGCCACCAGGCCACCCGCACCCTCTTGCCCTCT CTGCCCCTCCCTGAAGGATGGTTTTCTCATCTGGACACCCTTGGAAGCAAATCCTAG |
Restriction Sites | Please inquire |
ACCN | NM_001122951 |
Insert Size | 1000 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001122951.1, NP_001116423.1 |
RefSeq Size | 1106 bp |
RefSeq ORF | 1017 bp |
Locus ID | 2532 |
UniProt ID | Q16570 |
Cytogenetics | 1q23.2 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Summary | The protein encoded by this gene is a glycosylated membrane protein and a non-specific receptor for several chemokines. The encoded protein is the receptor for the human malarial parasites Plasmodium vivax and Plasmodium knowlesi. Polymorphisms in this gene are the basis of the Duffy blood group system. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) encodes the longer isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC225498 | DARC (Myc-DDK-tagged)-Human Duffy blood group, chemokine receptor (DARC), transcript variant 1 | 10 ug |
$686.00
|
|
RC225498L1 | Lenti ORF clone of Human Duffy blood group, chemokine receptor (DARC), transcript variant 1, Myc-DDK-tagged | 10 ug |
$986.00
|
|
RC225498L2 | Lenti ORF clone of Human Duffy blood group, chemokine receptor (DARC), transcript variant 1, mGFP tagged | 10 ug |
$986.00
|
|
RC225498L3 | Lenti ORF clone of Human Duffy blood group, chemokine receptor (DARC), transcript variant 1, Myc-DDK-tagged | 10 ug |
$986.00
|
|
RC225498L4 | Lenti ORF clone of Human Duffy blood group, chemokine receptor (DARC), transcript variant 1, mGFP tagged | 10 ug |
$986.00
|
|
RG225498 | DARC (tGFP-tagged) - Human Duffy blood group, chemokine receptor (DARC), transcript variant 1 | 10 ug |
$886.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.