Claudin 22 (CLDN22) (NM_001111319) Human Untagged Clone

SKU
SC318800
CLDN22 (untagged)-Human claudin 22 (CLDN22)
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Claudin 22
Synonyms CLDN21
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001111319 edited
CAGGACATTATAATGGCTTTAGTATTTAGAACTGTAGCTCAACTAGCTGGAGTTTCATTA
TCTTTGCTGGGATGGGTTTTATCCTGTCTTACAAACTACCTGCCACACTGGAAGAACCTC
AACCTGGACTTAAATGAAATGGAAAACTGGACCATGGGACTCTGGCAAACCTGTGTCATC
CAAGAGGAAGTGGGGATGCAATGCAAGGACTTTGACTCCTTCCTGGCTTTGCCTGCTGAA
CTCAGGGTCTCCAGGATCTTAATGTTTCTGTCAAATGGGCTGGGATTTCTGGGCCTGCTG
GTCTCTGGGTTTGGCCTGGACTGTTTGAGAATTGGAGAGAGTCAGAGAGATCTCAAGAGG
CGACTGCTGATCCTGGGAGGAATTCTGTCCTGGGCCTCGGGAGTCACAGCCCTGGTTCCC
GTCTCTTGGGTTGCCCACAAGACGGTTCAGGAGTTCTGGGATGAGAACGTCCCAGACTTT
GTCCCCAGGTGGGAGTTTGGGGAGGCCCTGTTTCTGGGCTGGTTTGCTGGACTTTCTCTT
CTGCTAGGAGGGTGTCTGCTCCACTGTGCAGCCTGCTCCAGCCACGCTCCCCTAGCTTCG
GGCCACTACGCAGTGGCACAAACACAAGATCATCATCAAGAACTGGAGACGAGAAACACC
AACCTGAAACACTAA
Restriction Sites Please inquire
ACCN NM_001111319
Insert Size 700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001111319.1, NP_001104789.1
RefSeq Size 2708 bp
RefSeq ORF 663 bp
Locus ID 53842
UniProt ID Q8N7P3
Cytogenetics 4q35.1
Protein Families Transmembrane
Protein Pathways Cell adhesion molecules (CAMs), Leukocyte transendothelial migration, Tight junction
Summary This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is intronless and overlaps the 3' UTR of the WWC2 gene (GeneID: 80014) on the opposite strand. [provided by RefSeq, Aug 2010]
Write Your Own Review
You're reviewing:Claudin 22 (CLDN22) (NM_001111319) Human Untagged Clone
Your Rating
SKU Description Size Price
RC225263 CLDN22 (Myc-DDK-tagged)-Human claudin 22 (CLDN22) 10 ug
$300.00
RC225263L3 Lenti ORF clone of Human claudin 22 (CLDN22), Myc-DDK-tagged 10 ug
$600.00
RC225263L4 Lenti ORF clone of Human claudin 22 (CLDN22), mGFP tagged 10 ug
$600.00
RG225263 CLDN22 (tGFP-tagged) - Human claudin 22 (CLDN22) 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.