RBCK1 (NM_031229) Human Untagged Clone

SKU
SC317857
RBCK1 (untagged)-Human RanBP-type and C3HC4-type zinc finger containing 1 (RBCK1), transcript variant 2
$761.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RBCK1
Synonyms C20orf18; HOIL-1; HOIL1; PBMEI; PGBM1; RBCK2; RNF54; UBCE7IP3; XAP3; XAP4; ZRANB4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317857 representing NM_031229.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGACGAGAAGACCAAGAAAGCAGAGGAAATGGCCCTGAGCCTCACCCGAGCAGTGGCGGGCGGGGAT
GAACAGGTGGCAATGAAGTGTGCCATCTGGCTGGCAGAGCAACGGGTGCCCCTGAGTGTGCAACTGAAG
CCTGAGGTCTCCCCAACGCAGGACATCAGGCTGTGGGTGAGCGTGGAGGATGCTCAGATGCACACCGTC
ACCATCTGGCTCACAGTGCGCCCTGATATGACAGTGGCGTCTCTCAAGGACATGGTTTTTCTGGACTAT
GGCTTCCCACCAGTCTTGCAGCAGTGGGTGATTGGGCAGCGGCTGGCACGAGACCAGGAGACCCTGCAC
TCCCATGGGGTGCGGCAGAATGGGGACAGTGCCTACCTCTATCTGCTGTCAGCCCGCAACACCTCCCTC
AACCCTCAGGAGCTGCAGCGGGAGCGGCAGCTGCGGATGCTGGAAGATCTGGGCTTCAAGGACCTCACG
CTGCAGCCGCGGGGCCCTCTGGAGCCAGGCCCCCCAAAGCCCGGGGTCCCCCAGGAACCCGGACGGGGG
CAGCCAGATGCAGTGCCTGAGCCCCCACCGGTGGGCTGGCAGTGCCCCGGGTGCACCTTCATCAACAAG
CCCACGCGGCCTGGCTGTGAGATGTGCTGCCGGGCGCGCCCCGAGGCCTACCAGGTCCCCGCCTCATAC
CAGCCCGACGAGGAGGAGCGAGCGCGCCTGGCGGGCGAGGAGGAGGCGCTGCGTCAGTACCAGCAGCGG
AAGCAGCAGCAGCAGGAGGGGAACTACCTGCAGCACGTCCAGCTGGACCAGAGGAGCCTGGTGCTGAAC
ACGGAGCCCGCCGAGTGCCCCGTGTGCTACTCGGTGCTGGCGCCCGGCGAGGCCGTGGTGCTGCGTGAG
TGTCTGCACACCTTCTGCAGGGAGTGCCTGCAGGGCACCATCCGCAACAGCCAGGAGGCGGAGGTCTCC
TGCCCCTTCATTGACAACACCTACTCGTGCTCGGGCAAGCTGCTGGAGAGGGAGATCAAGGCGCTCCTG
ACCCCTGAGGATTACCAGCGATTTCTAGACCTGGGCATCTCCATTGCTGAAAACCGCAGTGCCTTCAGC
TACCATTGCAAGACCCCAGATTGCAAGGGATGGTGCTTCTTTGAGGATGATGTCAATGAGTTCACCTGC
CCTGTGTGTTTCCACGTCAACTGCCTGCTCTGCAAGGCCATCCATGAGCAGATGAACTGCAAGGAGTAT
CAGGAGGACCTGGCCCTGCGGGCTCAGAACGATGTGGCTGCCCGGCAGACGACAGAGATGCTGAAGGTG
ATGCTGCAGCAGGGCGAGGCCATGCGCTGCCCCCAGTGCCAGATCGTGGTACAGAAGAAGGACGGCTGC
GACTGGATCCGCTGCACCGTCTGCCACACCGAGATCTGCTGGGTCACCAAGGGCCCACGCTGGGGCCCT
GGGGGCCCAGGAGACACCAGCGGGGGCTGCCGCTGCAGGGTAAATGGGATTCCTTGCCACCCAAGCTGT
CAGAACTGCCACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_031229
Insert Size 1533 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_031229.3
RefSeq Size 3963 bp
RefSeq ORF 1533 bp
Locus ID 10616
UniProt ID Q9BYM8
Cytogenetics 20p13
Domains RING, zf-RanBP
Protein Families Druggable Genome
MW 57.6 kDa
Summary The protein encoded by this gene is similar to mouse UIP28/UbcM4 interacting protein. Alternative splicing has been observed at this locus, resulting in distinct isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) encodes the longest isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:RBCK1 (NM_031229) Human Untagged Clone
Your Rating
SKU Description Size Price
RC203906 RBCK1 (Myc-DDK-tagged)-Human RanBP-type and C3HC4-type zinc finger containing 1 (RBCK1), transcript variant 2 10 ug
$686.00
RC203906L1 Lenti ORF clone of Human RanBP-type and C3HC4-type zinc finger containing 1 (RBCK1), transcript variant 2, Myc-DDK-tagged 10 ug
$986.00
RC203906L2 Lenti ORF clone of Human RanBP-type and C3HC4-type zinc finger containing 1 (RBCK1), transcript variant 2, mGFP tagged 10 ug
$986.00
RC203906L3 Lenti ORF clone of Human RanBP-type and C3HC4-type zinc finger containing 1 (RBCK1), transcript variant 2, Myc-DDK-tagged 10 ug
$986.00
RC203906L4 Lenti ORF clone of Human RanBP-type and C3HC4-type zinc finger containing 1 (RBCK1), transcript variant 2, mGFP tagged 10 ug
$986.00
RG203906 RBCK1 (tGFP-tagged) - Human RanBP-type and C3HC4-type zinc finger containing 1 (RBCK1), transcript variant 2 10 ug
$886.00
SC108003 RBCK1 (untagged)-Human RanBP-type and C3HC4-type zinc finger containing 1 (RBCK1), transcript variant 2 10 ug
$699.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.