TTC19 (NM_017775) Human Untagged Clone

CAT#: SC317843

TTC19 (untagged)-Human tetratricopeptide repeat domain 19 (TTC19), transcript variant 1


  "NM_017775" in other vectors (7)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "TTC19"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TTC19
Synonyms 2010204O13Rik; MC3DN2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317843 representing NM_017775.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTCCGGCTCCTGAGCTGGAGCCTGGGCCGAGGCTTCCTGCGGGCCGCGGGGCGGCGGTGCCGGGGC
TGCTCCGCGCGCCTGCTCCCGGGGCTGGCAGGAGGTCCGGGGCCCGAGGTGCAGGTGCCGCCATCCCGA
GTCGCGCCGCACGGCCGGGGCCCAGGCCTGCTGCCGCTGCTGGCAGCGCTCGCCTGGTTCTCGAGGCCC
GCTGCGGCAGAGGAGGAGGAGCAGCAGGGAGCCGACGGGGCCGCTGCCGAGGACGGGGCGGACGAGGCC
GAGGCAGAGATCATCCAGCTGCTGAAGCGAGCCAAGTTGAGCATTATGAAAGATGAGCCAGAAGAGGCT
GAGTTAATTTTGCATGACGCTCTTCGTCTCGCCTATCAGACTGATAACAAGAAGGCCATCACTTACACT
TATGATTTGATGGCCAACTTAGCATTTATACGGGGTCAGCTTGAAAATGCTGAACAACTTTTTAAAGCA
ACAATGAGTTACCTCCTTGGAGGGGGCATGAAGCAGGAGGACAATGCAATAATTGAAATTTCCCTAAAG
CTGGCCAGTATCTATGCTGCGCAGAACAGACAGGAATTTGCTGTTGCTGGCTATGAATTCTGCATTTCA
ACTCTAGAGGAAAAAATTGAAAGAGAAAAGGAATTAGCAGAAGACATTATGTCAGTGGAAGAGAAAGCC
AATACCCACCTCCTCTTGGGCATGTGCTTAGACGCCTGTGCTCGCTACCTTCTGTTCTCCAAGCAGCCG
TCACAGGCACAAAGGATGTATGAAAAAGCTCTGCAGATTTCTGAAGAAATACAAGGAGAAAGACACCCA
CAGACCATTGTGCTGATGAGTGACCTGGCTACTACCCTGGATGCACAGGGCCGCTTTGATGAGGCCTAT
ATTTATATGCAAAGGGCATCAGATCTGGCAAGACAGATAAATCATCCTGAGCTACACATGGTACTCAGT
AATCTAGCTGCAGTTTTGATGCACAGAGAACGATATACACAAGCAAAAGAGATCTACCAGGAAGCACTG
AAGCAAGCAAAGCTGAAAAAAGATGAAATTTCTGTACAACACATCAGGGAAGAGTTGGCTGAGCTGTCA
AAGAAAAGTAGACCTTTGACAAATTCTGTCAAGCTCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_017775
Insert Size 1143 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_017775.3
RefSeq Size 3505 bp
RefSeq ORF 1143 bp
Locus ID 54902
UniProt ID Q6DKK2
Cytogenetics 17p12
Domains TPR
MW 42.5 kDa
Gene Summary This gene encodes a protein with a tetratricopeptide repeat (TPR) domain containing several TPRs of about 34 aa each. These repeats are found in a variety of organisms including bacteria, fungi and plants, and are involved in a variety of functions including protein-protein interactions. This protein is embedded in the inner mitochondrial membrane and is involved in the formation of the mitochondrial respiratory chain III. It has also been suggested that this protein plays a role in cytokinesis. Mutations in this gene cause mitochondrial complex III deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2012]
Transcript Variant: This variant (1) represents the shorter transcript but encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.