TA3 (TAAR9) (NM_175057) Human Untagged Clone

SKU
SC317545
TAAR9 (untagged)-Human trace amine associated receptor 9 (gene/pseudogene) (TAAR9)
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TA3
Synonyms TA3; TAR3; TAR9; TRAR3
Vector pCMV6-XL6
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_175057 edited
ATGGTGAACAATTTCTCCCAAGCTGAGGCTGTGGAGCTGTGTTACAAGAACGTGAACGAA
TCCTGCATTAAAACTCCTTACTCGCCAGGTCCTCGATCTATCCTCTACGCCGTCCTTGGT
TTTGGGGCTGTGCTGGCAGCGTTTGGAAACTTACTGGTCATGATTGCTATCCTTCACTTC
AAACAACTGCACACACCTACAAACTTTCTGATTGCGTCGCTGGCCTGTGCTGACTTCTTG
GTGGGAGTCACTGTGATGCCCTTCAGCACAGTGAGGTCTGTGGAGAGCTGTTGGTACTTT
GGGGACAGTTACTGTAAATTCCATACATGTTTTGACACATCCTTCTGTTTTGCTTCTTTA
TTTCATTTATGCTGTATCTCTGTTGATAGATACATTGCTGTTACTGATCCTCTGACCTAT
CCAACCAAGTTTACTGTGTCAGTTTCAGGGATATGCATTGTTCTTTCCTGGTTCTTTTCT
GTCACATACAGCTTTTCGATCTTTTACACGGGAGCCAACGAAGAAGGAATTGAGGAATTA
GTAGTTGCTCTAACCTGTGTAGGAGGCTGCCAGGCTCCACTGAATCAAAACTGGGTCCTA
CTTTGTTTTCTTCTATTCTTTATACCCAATGTCGCCATGGTGTTTATATACAGTAAGATA
TTTTTGGTGGCCAAGCATCAGGCTAGGAAGATAGAAAGTACAGCCAGCCAAGCTCAGTCC
TCCTCAGAGAGTTACAAGGAAAGAGTAGCAAAAAGAGAGAGAAAGGCTGCCAAAACCTTG
GGAATTGCTATGGCAGCATTTCTTGTCTCTTGGCTACCATACCTCGTTGATGCAGTGATT
GATGCTTATATGAATTTTATAACTCCTCCTTATGTTTATGAGATTTTAGTTTGGTGTGTT
TATTATAATTCAGCTATGAACCCCTTGATTTATGCTTTCTTTTACCAATGGTTTGGGAAG
GCAATAAAACTTATTGTAAGCGGCAAGGTCTTAAGGACTGATTCGTCAACAACTAATTTA
TTTTCTGAAGAAGTAGAGACAGATTA:A
Restriction Sites Please inquire
ACCN NM_175057
Insert Size 1100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_175057.3, NP_778227.3
RefSeq Size 1049 bp
RefSeq ORF 1047 bp
Locus ID 134860
UniProt ID Q96RI9
Cytogenetics 6q23.2
Protein Families Druggable Genome
Protein Pathways Neuroactive ligand-receptor interaction
Summary TAAR9 is a member of a large family of rhodopsin G protein-coupled receptors (GPCRs, or GPRs). GPCRs contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins.[supplied by OMIM, Jul 2005]
Write Your Own Review
You're reviewing:TA3 (TAAR9) (NM_175057) Human Untagged Clone
Your Rating
SKU Description Size Price
RC223711 TAAR9 (Myc-DDK-tagged)-Human trace amine associated receptor 9 (gene/pseudogene) (TAAR9) 10 ug
$457.00
RC223711L1 Lenti ORF clone of Human trace amine associated receptor 9 (gene/pseudogene) (TAAR9), Myc-DDK-tagged 10 ug
$757.00
RC223711L2 Lenti ORF clone of Human trace amine associated receptor 9 (gene/pseudogene) (TAAR9), mGFP tagged 10 ug
$757.00
RC223711L3 Lenti ORF clone of Human trace amine associated receptor 9 (gene/pseudogene) (TAAR9), Myc-DDK-tagged 10 ug
$757.00
RC223711L4 Lenti ORF clone of Human trace amine associated receptor 9 (gene/pseudogene) (TAAR9), mGFP tagged 10 ug
$757.00
RG223711 TAAR9 (tGFP-tagged) - Human trace amine associated receptor 9 (gene/pseudogene) (TAAR9) 10 ug
$489.00 MSRP $657.00 MSRP $657.00
SC126680 TAAR9 (untagged)-Human trace amine associated receptor 9 (gene/pseudogene) (TAAR9) 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.