METTL9 (NM_016025) Human Untagged Clone

CAT#: SC317482

METTL9 (untagged)-Human methyltransferase like 9 (METTL9), transcript variant 1


  "NM_016025" in other vectors (5)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
METTL9 Rabbit pAb
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "METTL9"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol METTL9
Synonyms CGI-81; DREV; DREV1; PAP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317482 representing NM_016025.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGACTGCTGGCGGGCTGGCTGTGCCTGAGCCTGGCGTCCGTGTGGCTGGCGCGGAGGATGTGGACG
CTGCGGAGCCCGCTCACCCGCTCCCTGTACGTGAACATGACTAGCGGCCCGGGTGGGCCGGCGGCGGCC
GCGGGCGGCAGGAAGGAGAACCACCAGTGGTATGTGTGCAACAGAGAGAAATTATGCGAATCACTCCAG
GCTGTCTTTGTTCAGAGTTACCTTGATCAAGGAACACAGATCTTCTTAAACAACAGCATTGAGAAATCG
GGCTGGCTATTTATCCAATTATATCATTCTTTTGTGTCATCTGTTTTTAGCCTGTTTATGTCTAGAACA
TCTATCAATGGGTTGCTAGGAAGAGGCTCAATGTTTGTGTTTTCACCAGATCAGTTTCAGAGACTGCTT
AAAATTAATCCAGACTGGAAAACCCACAGACTTCTTGATTTAGGTGCTGGAGATGGAGAAGTCACAAAA
ATCATGAGCCCTCATTTTGAAGAAATCTATGCCACTGAGCTTTCTGAAACTATGATATGGCAGCTTCAG
AAAAAGAAATACAGAGTCCTTGGTATAAATGAATGGCAGAATACGGGGTTCCAGTATGATGTCATCAGC
TGCCTGAACTTGCTGGACCGCTGTGATCAGCCCCTGACTTTGTTAAAAGATATCAGAAGTGTCTTGGAG
CCAACTAGAGGCAGGGTCATCCTTGCCCTTGTCCTCCCCTTTCATCCCTATGTGGAAAACGTAGGTGGC
AAGTGGGAGAAACCATCAGAAATTTTGGAAATCAAAGGACAGAACTGGGAAGAACAAGTGAATAGTCTG
CCTGAAGTTTTCAGAAAAGCTGGTTTTGTTATCGAAGCTTTCACCAGACTACCATACCTGTGTGAAGGC
GACATGTATAATGACTACTACGTTCTGGATGACGCTGTCTTTGTTCTCAAACCAGTATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_016025
Insert Size 957 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_016025.4
RefSeq Size 3267 bp
RefSeq ORF 957 bp
Locus ID 51108
UniProt ID Q9H1A3
Cytogenetics 16p12.2
Domains DREV
MW 36.5 kDa
Gene Summary Protein-histidine N-methyltransferase that specifically catalyzes 1-methylhistidine (pros-methylhistidine) methylation of target proteins (PubMed:33563959). Mediates methylation of proteins with a His-x-His (HxH) motif (where 'x' is preferably a small amino acid) (PubMed:33563959). Catalyzes methylation of target proteins such as S100A9, NDUFB3, SLC39A5, SLC39A7, ARMC6 and DNAJB12; 1-methylhistidine modification may affect the binding of zinc and other metals to its target proteins (PubMed:33563959). Constitutes the main methyltransferase for the 1-methylhistidine modification in cell (PubMed:33563959).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.