CCDC106 (NM_013301) Human Untagged Clone

CAT#: SC317402

CCDC106 (untagged)-Human coiled-coil domain containing 106 (CCDC106)


  "NM_013301" in other vectors (5)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-CCDC106 Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "CCDC106"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CCDC106
Synonyms HSU79303; ZNF581
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317402 representing NM_013301.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAATGACCGGAGCAGTCGGAGGCGGACAATGAAGGACGATGAGACCTTCGAGATCTCCATTCCCTTC
GATGAGGCACCCCACCTAGACCCACAGATCTTTTACAGTCTGAGCCCCTCTCGGAGAAACTTCGAGGAG
CCTCCGGAGGCTGCGTCCTCCGCCCTGGCTCTGATGAACAGCGTCAAGACCCAGCTGCACATGGCTCTG
GAGAGGAACTCCTGGCTGCAGAAGCGCATCGAGGACCTGGAGGAAGAGAGGGACTTCCTGCGGTGCCAG
CTGGACAAATTCATCTCTTCTGCTCGGATGGAGGCAGAGGACCACTGCCGGATGAAGCCTGGGCCCAGG
CGGATGGAGGGGGACAGCCGTGGTGGGGCTGGGGGCGAGGCCTCGGACCCTGAGTCAGCAGCCTCCTCC
CTCAGCGGAGCGTCCGAAGAAGGCAGCGCCAGTGAGAGGAGGCGGCAGAAGCAGAAGGGAGGTGCTAGT
CGGAGGCGCTTTGGGAAGCCCAAGGCCCGGGAGAGGCAGCGAGTGAAGGACGCCGACGGGGTCCTCTGC
CGGTACAAGAAGATCCTGGGCACCTTCCAGAAGCTCAAGAGCATGTCGCGGGCCTTCGAGCACCACCGC
GTGGACAGGAACACCGTGGCGCTGACCACGCCCATCGCCGAGCTGCTCATTGTGGCCCCCGAGAAGCTG
GCCGAGGTGGGCGAGTTCGACCCCTCCAAGGAGCGCCTGCTCGAGTACTCCCGCCGCTGCTTTCTGGCC
CTGGACGACGAGACGCTCAAGAAGGTGCAGGCGCTCAAGAAGAGCAAGCTGCTGCTGCCCATCACCTAC
CGCTTCAAGCGGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_013301
Insert Size 843 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_013301.2
RefSeq Size 1993 bp
RefSeq ORF 843 bp
Locus ID 29903
UniProt ID Q9BWC9
Cytogenetics 19q13.42
MW 32 kDa
Gene Summary Promotes the degradation of p53/TP53 protein and inhibits its transactivity.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.