FAM55D (NXPE4) (NM_017678) Human Untagged Clone

SKU
SC317372
NXPE4 (untagged)-Human family with sequence similarity 55, member D (FAM55D), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol FAM55D
Synonyms C11orf33; FAM55D
Vector pCMV6 series
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_017678, the custom clone sequence may differ by one or more nucleotides
ATGGAAAAATTCAATACAATTAGTGTCTCCAAATGCAACAAAGAAACAGTTGCAATGAAA
GAGAAATGCAAGTTTGGAATGACATCCACAATCCCCAGTGGGCATGTCTGGAGAAACACA
TGGAATCCTGTCTCCTGTAGTTTGGCTACAGTCAAAATGAAGGAATGCCTGAGAGGAAAA
CTCATATACCTAATGGGAGATTCCACGATCCGCCAGTGGATGGAATACTTCAAAGCCAGT
ATCAACACACTGAAGTCAGTGGATCTGCATGAATCTGGAAAATTGCAACACCAGCTTGCT
GTGGATTTGGATAGGAACATCAACATCCAGTGGCAAAAATATTGTTATCCCTTGATAGGA
TCAATGACCTATTCAGTCAAAGAGATGGAGTACCTCACCCGGGCCATTGACAGAACTGGA
GGAGAAAAAAATACTGTCATTGTTATTTCCCTGGGCCAGCATTTCAGACCCTTTCCCATT
GATGTTTTTATCCGAAGGGCCCTCAATGTCCACAAAGCCATTCAGCATCTTCTTCTGAGA
AGCCCAGACACTATGGTTATCATCAAAACAGAAAACATCAGGGAGATGTACAATGATGCA
GAAAGATTTAGTGACTTTCATGGTTACATTCAATATCTCATCATAAAGGACATTTTCCAG
GATCTCAGTGTGAGTATCATTGATGCCTGGGATATAACAATTGCATATGGCACAAATAAT
GTACACCCACCTCAACATGTAGTCGGAAATCAGATTAATATATTATTAAACTATATTTGT
Restriction Sites Please inquire
ACCN NM_017678
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_017678.2, NP_060148.2
RefSeq Size 1715 bp
RefSeq ORF 783 bp
Locus ID 54827
UniProt ID Q6UWF7
Cytogenetics 11q23.2
Protein Families Secreted Protein, Transmembrane
Write Your Own Review
You're reviewing:FAM55D (NXPE4) (NM_017678) Human Untagged Clone
Your Rating
SKU Description Size Price
RC214326 NXPE4 (Myc-DDK-tagged)-Human family with sequence similarity 55, member D (FAM55D), transcript variant 2 10 ug
$330.00
RC214326L3 Lenti-ORF clone of NXPE4 (Myc-DDK-tagged)-Human family with sequence similarity 55, member D (FAM55D), transcript variant 2 10 ug
$630.00
RC214326L4 Lenti-ORF clone of NXPE4 (mGFP-tagged)-Human family with sequence similarity 55, member D (FAM55D), transcript variant 2 10 ug
$630.00
RG214326 NXPE4 (tGFP-tagged) - Human family with sequence similarity 55, member D (FAM55D), transcript variant 2 10 ug
$530.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.