Septin 11 (SEPT11) (NM_018243) Human Untagged Clone

SKU
SC316993
41528 (untagged)-Human septin 11 (SEPT11)
$457.00
4 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Septin 11
Synonyms SEPT11
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_018243, the custom clone sequence may differ by one or more nucleotides


ATGGCCGTGGCCGTGGGGAGACCGTCTAATGAAGAGCTTCGAAACTTGTCTTTGTCTGGCCATGTGGGAT
TTGACAGCCTCCCTGACCAGCTGGTCAACAAGTCTACTTCTCAAGGATTCTGTTTCAACATCCTTTGTGT
TGGTGAGACAGGCATTGGCAAATCCACGTTAATGGACACTTTGTTCAACACCAAATTTGAAAGTGACCCA
GCTACTCACAATGAACCAGGTGTTCGGTTAAAAGCCAGAAGTTATGAGCTTCAGGAAAGCAATGTACGGC
TGAAGTTAACCATTGTTGACACCGTGGGATTTGGAGACCAGATAAATAAAGATGACAGCTATAAGCCGAT
AGTAGAATATATTGATGCCCAGTTCGAGGCCTACCTGCAAGAGGAATTGAAGATTAAACGTTCTCTCTTC
AACTACCATGACACGAGGATCCATGCCTGCCTCTACTTTATTGCCCCTACTGGACATTCACTAAAGTCCC
TGGATCTGGTCACCATGAAAAAGCTGGACAGTAAGGTGAACATCATTCCAATAATTGCAAAAGCTGACAC
CATTGCCAAGAATGAACTGCACAAATTCAAGAGTAAGATCATGAGTGAACTGGTCAGCAATGGGGTCCAG
ATATATCAGTTTCCCACTGATGAAGAAACGGTGGCAGAGATTAACGCAACAATGAGTGTCCATCTCCCAT
TTGCAGTGGTTGGCAGCACCGAAGAGGTGAAGATTGGCAACAAGATGGCAAAGGCCAGGCAGTACCCCTG
GGGTGTGGTGCAGGTTGAGAATGAAAATCATTGCGATTTTGTGAAACTTCGAGAGATGCTGATCCGCGTG
AACATGGAGGACTTGCGAGAGCAGACTCACACCCGCCACTATGAATTGTACCGACGCTGTAAGCTTGAAG
AGATGGGGTTCAAGGACACTGACCCTGACAGCAAACCCTTCAGTCTTCAGGAGACATATGAAGCAAAAAG
GAATGAATTCCTGGGAGAACTGCAGAAGAAAGAAGAAGAAATGAGACAAATGTTTGTTATGAGAGTGAAG
GAGAAAGAAGCTGAACTTAAGGAGGCAGAGAAAGAGCTTCACGAGAAGTTTGACCTTCTAAAGCGGACAC
ACCAAGAAGAAAAGAAGAAAGTGGAAGACAAGAAGAAGGAGCTTGAGGAGGAGGTGAACAACTTCCAGAA
GAAGAAAGCAGCGGCTCAGTTACTACAGTCCCAGGCCCAGCAATCTGGGGCCCAGCAAACCAAGAAAGAC
AAGGATAAGAAAAATGCAAGCTTCACATAA


Restriction Sites NotI-NotI
ACCN NM_018243
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.NA
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_018243.2, NP_060713.1
RefSeq Size 5582 bp
RefSeq ORF 1290 bp
Locus ID 55752
UniProt ID Q9NVA2
Cytogenetics 4q21.1
Domains GTP_CDC
Summary SEPT11 belongs to the conserved septin family of filament-forming cytoskeletal GTPases that are involved in a variety of cellular functions including cytokinesis and vesicle trafficking (Hanai et al., 2004 [PubMed 15196925]; Nagata et al., 2004 [PubMed 15485874]).[supplied by OMIM, Jul 2009]
Transcript Variant: This variant (2) differs in the 5' UTR and lacks an exon in the 5' coding region that results in use of an alternate start codon compared to variant 1. It encodes isoform 2, which has a novel N-terminus and is shorter than isoform 1.
Write Your Own Review
You're reviewing:Septin 11 (SEPT11) (NM_018243) Human Untagged Clone
Your Rating
SKU Description Size Price
RC209525 SEPT11 (Myc-DDK-tagged)-Human septin 11 (SEPT11) 10 ug
$457.00
RC209525L3 Lenti ORF clone of Human septin 11 (SEPT11), Myc-DDK-tagged 10 ug
$757.00
RC209525L4 Lenti ORF clone of Human septin 11 (SEPT11), mGFP tagged 10 ug
$757.00
RG209525 41528 (tGFP-tagged) - Human septin 11 (SEPT11) 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.