CYP11A1 (NM_001099773) Human Untagged Clone

SKU
SC316732
CYP11A1 (untagged)-Human cytochrome P450, family 11, subfamily A, polypeptide 1 (CYP11A1), transcript variant 2
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CYP11A1
Synonyms CYP11A; CYPXIA1; P450SCC
Vector pCMV6 series
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001099773, the custom clone sequence may differ by one or more nucleotides
ATGGCTCCAGAGGCCACCAAGAACTTTTTGCCCCTGTTGGATGCAGTGTCTCGGGACTTC
GTCAGTGTCCTGCACAGGCGCATCAAGAAGGCGGGCTCCGGAAATTACTCGGGGGACATC
AGTGATGACCTGTTCCGCTTTGCCTTTGAGTCCATCACTAACGTCATTTTTGGGGAGCGC
CAGGGGATGCTGGAGGAAGTAGTGAACCCCGAGGCCCAGCGATTCATTGATGCCATCTAC
CAGATGTTCCACACCAGCGTCCCCATGCTCAACCTTCCCCCAGACCTGTTCCGTCTGTTC
AGGACCAAGACCTGGAAGGACCATGTGGCTGCATGGGACGTGATTTTCAGTAAAGCTGAC
ATATACACCCAGAACTTCTACTGGGAATTGAGACAGAAAGGAAGTGTTCACCACGATTAC
CGTGGCATCCTCTACAGACTCCTGGGAGACAGCAAGATGTCCTTCGAGGACATCAAGGCC
AACGTCACAGAGATGCTGGCAGGAGGGGTGGACACGACGTCCATGACCCTGCAGTGGCAC
TTGTATGAGATGGCACGCAACCTGAAGGTGCAGGATATGCTGCGGGCAGAGGTCTTGGCT
GCGCGGCACCAGGCCCAGGGAGACATGGCCACGATGCTACAGCTGGTCCCCCTCCTCAAA
GCCAGCATCAAGGAGACACTAAGACTTCACCCCATCTCCGTGACCCTGCAGAGATATCTT
GTAAATGACTTGGTTCTTCGAGATTACATGATTCCTGCCAAGACACTGGTGCAAGTGGCC
ATCTATGCTCTGGGCCGAGAGCCCACCTTCTTCTTCGACCCGGAAAATTTTGACCCAACC
CGATGGCTGAGCAAAGACAAGAACATCACCTACTTCCGGAACTTGGGCTTTGGCTGGGGT
GTGCGGCAGTGTCTGGGACGGCGGATCGCTGAGCTAGAGATGACCATCTTCCTCATCAAT
ATGCTGGAGAACTTCAGAGTTGAAATCCAACACCTCAGCGATGTGGGCACCACATTCAAC
CTCATTCTGATGCCTGAAAAGCCCATCTCCTTCACCTTCTGGCCCTTTAACCAGGAAGCA
ACCCAGCAG
Restriction Sites Please inquire
ACCN NM_001099773
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001099773.1, NP_001093243.1
RefSeq Size 2010 bp
RefSeq ORF 1092 bp
Locus ID 1583
UniProt ID P05108
Cytogenetics 15q24.1
Protein Families Druggable Genome, P450
Protein Pathways C21-Steroid hormone metabolism, Metabolic pathways
Summary This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane and catalyzes the conversion of cholesterol to pregnenolone, the first and rate-limiting step in the synthesis of the steroid hormones. Two transcript variants encoding different isoforms have been found for this gene. The cellular location of the smaller isoform is unclear since it lacks the mitochondrial-targeting transit peptide. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses an alternate first exon compared to variant 1, resulting in the translation start site being located at a downstream AUG. The resulting isoform (b) is shorter at the N-terminus compared to isoform a.
Write Your Own Review
You're reviewing:CYP11A1 (NM_001099773) Human Untagged Clone
Your Rating
SKU Description Size Price
RC211728 CYP11A1 (Myc-DDK-tagged)-Human cytochrome P450, family 11, subfamily A, polypeptide 1 (CYP11A1), transcript variant 2 10 ug
$289.00 MSRP $457.00 MSRP $457.00
RC211728L3 Lenti-ORF clone of CYP11A1 (Myc-DDK-tagged)-Human cytochrome P450, family 11, subfamily A, polypeptide 1 (CYP11A1), transcript variant 2 10 ug
$757.00
RC211728L4 Lenti-ORF clone of CYP11A1 (mGFP-tagged)-Human cytochrome P450, family 11, subfamily A, polypeptide 1 (CYP11A1), transcript variant 2 10 ug
$757.00
RG211728 CYP11A1 (tGFP-tagged) - Human cytochrome P450, family 11, subfamily A, polypeptide 1 (CYP11A1), transcript variant 2 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.