ADAM17 (NM_003183) Human Untagged Clone

CAT#: SC316426

ADAM17 (untagged)-Human ADAM metallopeptidase domain 17 (ADAM17)

USD 721


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name ADAM17 (NM_003183) Human Untagged Clone
Symbol ADAM17
Synonyms ADAM18; CD156B; CSVP; NISBD; NISBD1; TACE
Vector pCMV6-Neo
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_003183 edited
ATGAGGCAGTCTCTCCTATTCCTGACCAGCGTGGTTCCTTTCGTGCTGGCGCCGCGACCT
CCGGATGACCCGGGCTTCGGCCCCCACCAGAGACTCGAGAAGCTTGATTCTTTGCTCTCA
GACTACGATATTCTCTCTTTATCTAATATCCAGCAGCATTCGGTAAGAAAAAGAGATCTA
CAGACTTCAACACATGTAGAAACACTACTAACTTTTTCAGCTTTGAAAAGGCATTTTAAA
TTATACCTGACATCAAGTACTGAACGTTTTTCACAAAATTTCAAGGTCGTGGTGGTGGAT
GGTAAAAACGAAAGCGAGTACACTGTAAAATGGCAGGACTTCTTCACTGGACACGTGGTT
GGTGAGCCTGACTCTAGGGTTCTAGCCCACATAAGAGATGATGATGTTATAATCAGAATC
AACACAGATGGGGCCGAATATAACATAGAGCCACTTTGGAGATTTGTTAATGATACCAAA
GACAAAAGAATGTTAGTTTATAAATCTGAAGATATCAAGAATGTTTCACGTTTGCAGTCT
CCCAAAGTGTGTGGTTATTTAAAAGTGGATAATGAAGAGTTGCTCCCAAAAGGGTTAGTA
GACAGAGAACCACCTGAAGAGCTTGTTCATCGAGTGAAAAGAAGAGCTGACCCAGATCCC
ATGAAGAACACGTGTAAATTATTGGTGGTAGCAGATCATCGCTTCTACAGATACATGGGC
AGAGGGGAAGAGAGTACAACTACAAATTACTTAATAGAGCTAATTGACAGAGTTGATGAC
ATCTATCGGAACACTTCATGGGATAATGCAGGTTTTAAAGGCTATGGAATACAGATAGAG
CAGATTCGCATTCTCAAGTCTCCACAAGAGGTAAAACCTGGTGAAAAGCACTACAACATG
GCAAAAAGTTACCCAAATGAAGAAAAGGATGCTTGGGATGTGAAGATGTTGCTAGAGCAA
TTTAGCTTTGATATAGCTGAGGAAGCATCTAAAGTTTGCTTGGCACACCTTTTCACATAC
CAAGATTTTGATATGGGAACTCTTGGATTAGCTTATGTTGGCTCTCCCAGAGCAAACAGC
CATGGAGGTGTTTGTCCAAAGGCTTATTATAGCCCAGTTGGGAAGAAAAATATCTATTTG
AATAGTGGTTTGACGAGCACAAAGAATTATGGTAAAACCATCCTTACAAAGGAAGCTGAC
CTGGTTACAACTCATGAATTGGGACATAATTTTGGAGCAGAACATGATCCGGATGGTCTA
GCAGAATGTGCCCCGAATGAGGACCAGGGAGGGAAATATGTCATGTATCCCATAGCTGTG
AGTGGCGATCACGAGAACAATAAGATGTTTTCAAACTGCAGTAAACAATCAATCTATAAG
ACCATTGAAAGTAAGGCCCAGGAGTGTTTTCAAGAACGCAGCAATAAAGTTTGTGGGAAC
TCGAGGGTGGATGAAGGAGAAGAGTGTGATCCTGGCATCATGTATCTGAACAACGACACC
TGCTGCAACAGCGACTGCACGTTGAAGGAAGGTGTCCAGTGCAGTGACAGGAACAGTCCT
TGCTGTAAAAACTGTCAGTTTGAGACTGCCCAGAAGAAGTGCCAGGAGGCGATTAATGCT
ACTTGCAAAGGCGTGTCCTACTGCACAGGTAATAGCAGTGAGTGCCCGCCTCCAGGAAAT
GCTGAAGATGACACTGTTTGCTTGGATCTTGGCAAGTGTAAGGATGGGAAATGCATCCCT
TTCTGCGAGAGGGAACAGCAGCTGGAGTCCTGTGCATGTAATGAAACTGACAACTCCTGC
AAGGTGTGCTGCAGGGACCTTTCTGGCCGCTGTGTGCCCTATGTCGATGCTGAACAAAAG
AACTTATTTTTGAGGAAAGGAAAGCCCTGTACAGTAGGATTTTGTGACATGAATGGCAAA
TGTGAGAAACGAGTACAGGATGTAATTGAACGATTTTGGGATTTCATTGACCAGCTGAGC
ATCAATACTTTTGGAAAGTTTTTAGCAGACAACATCGTTGGGTCTGTCCTGGTTTTCTCC
TTGATATTTTGGATTCCTTTCAGCATTCTTGTCCATTGTGTGGATAAGAAATTGGATAAA
CAGTATGAATCTCTGTCTCTGTTTCACCCCAGTAACGTCGAAATGCTGAGCAGCATGGAT
TCTGCATCGGTTCGCATTATCAAACCCTTTCCTGCGCCCCAGACTCCAGGCCGCCTGCAG
CCTGCCCCTGTGATCCCTTCGGCGCCAGCAGCTCCAAAACTGGACCACCAGAGAATGGAC
ACCATCCAGGAAGACCCCAGCACAGACTCACATATGGACGAGGATGGGTTTGAGAAGGAC
CCCTTCCCAAATAGCAGCACAGCTGCCAAGTCATTTGAGGATCTCACGGACCATCCGGTC
ACCAGAAGTGAAAAGGCTGCCTCCTTTAAACTGCAGCGTCAGAATCGTGTTGACAGCAAA
GAAACAGAGTGCTAA
Tag Tag Free
ACCN NM_003183
ORF Size 2475 bp
Insert Size 2500
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.NA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_003183.4, NP_003174
RefSeq Size 3572
RefSeq ORF 2475
Locus ID 6868
Cytogenetics 2p25.1
Protein Families Transmembrane, Protease, Druggable Genome
Protein Pathways Notch signaling pathway, Alzheimer's disease, Epithelial cell signaling in Helicobacter pylori infection
Gene Summary This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biologic processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The encoded preproprotein is proteolytically processed to generate the mature protease. The encoded protease functions in the ectodomain shedding of tumor necrosis factor-alpha, in which soluble tumor necrosis factor-alpha is released from the membrane-bound precursor. This protease also functions in the processing of numerous other substrates, including cell adhesion proteins, cytokine and growth factor receptors and epidermal growth factor (EGF) receptor ligands. The encoded protein also plays a prominent role in the activation of the Notch signaling pathway. Elevated expression of this gene has been observed in specific cell types derived from psoriasis, rheumatoid arthritis, multiple sclerosis and Crohn's disease patients, suggesting that the encoded protein may play a role in autoimmune disease. [provided by RefSeq, Feb 2016]
Transcript Variant: This variant (1) contains a 50 bps insertion in 3'- coding region, as compared to variant 2. As a result of an insertion and frame shift, isoform 1 encoded by variant 1 has a cytolasmic domain containing 130 amino acids, which is absent in isoform 2 encoded by variant 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations