CEACAM21 (NM_001098506) Human Untagged Clone

SKU
SC316356
CEACAM21 (untagged)-Human carcinoembryonic antigen-related cell adhesion molecule 21 (CEACAM21), transcript variant 1
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CEACAM21
Synonyms CEACAM3; R29124_1
Vector pCMV6 series
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001098506, the custom clone sequence may differ by one or more nucleotides
ATGGGGCCCCCCTCAGCTTGTCCCCACAGAGAATGCATCCCCTGGCAGGGGCTCTTGCTC
ACAGCCTCACTTTTAACTTTCTGGAACGCACCCACCACTGCCTGGCTCTTTATTGCATCA
GCGCCCTTTGAAGTTGCTGAAGGGGAGAATGTTCATCTCTCTGTGGTTTATCTGCCCGAG
AATCTTTACAGCTATGGCTGGTACAAAGGGAAAACGGTGGAGCCCAACCAGCTAATCGCA
GCATATGTAATAGACACTCACGTTAGGACTCCAGGGCCTGCATACAGCGGTCGAGAGACA
ATATCACCCAGTGGAGATCTGCATTTCCAGAACGTCACCCTAGAGGACACGGGATACTAC
AACCTACAAGTCACATACAGAAATTCTCAGATTGAACAGGCATCTCACCATCTCCGTGTA
TACGAGTCAGTGGCTCAGCCCTCCATCCAAGCCAGCAGCACCACAGTCACAGAGAAGGGC
TCCGTGGTCCTGACCTGCCACACAAATAACACTGGAACCTCTTTCCAGTGGATTTTCAAC
AACCAGCGTCTGCAGGTCACGAAGAGGATGAAGCTGTCCTGGTTTAACCATGTGCTCACC
ATAGACCCCATCAGGCAGGAGGACGCTGGGGAGTATCAGTGTGAGGTCTCCAACCCAGTC
AGCTCCAACAGGAGCGACCCCCTCAAGCTGACTGTAAAATCAGATGACAACACTCTAGGC
ATCCTGATCGGGGTCCTGGTTGGGAGTCTTCTGGTGGCTGCACTTGTGTGTTTCCTGCTC
CTCCGAAAAACTGGCAGGGCCAGCGATCAGAGTGACTTCAGGGAGCAGCAGCCCCCAGCC
TCCACCCCCGGCCATGGACCCTCTGACAGCTCCATCTCC
Restriction Sites Please inquire
ACCN NM_001098506
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001098506.1, NP_001091976.1
RefSeq Size 1378 bp
RefSeq ORF 882 bp
Locus ID 90273
UniProt ID Q3KPI0
Cytogenetics 19q13.2
Protein Families Transmembrane
Write Your Own Review
You're reviewing:CEACAM21 (NM_001098506) Human Untagged Clone
Your Rating
SKU Description Size Price
RC211793 CEACAM21 (Myc-DDK-tagged)-Human carcinoembryonic antigen-related cell adhesion molecule 21 (CEACAM21), transcript variant 1 10 ug
$330.00
RC211793L3 Lenti-ORF clone of CEACAM21 (Myc-DDK-tagged)-Human carcinoembryonic antigen-related cell adhesion molecule 21 (CEACAM21), transcript variant 1 10 ug
$630.00
RC211793L4 Lenti-ORF clone of CEACAM21 (mGFP-tagged)-Human carcinoembryonic antigen-related cell adhesion molecule 21 (CEACAM21), transcript variant 1 10 ug
$630.00
RG211793 CEACAM21 (tGFP-tagged) - Human carcinoembryonic antigen-related cell adhesion molecule 21 (CEACAM21), transcript variant 1 10 ug
$489.00 MSRP $530.00 MSRP $530.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.