Folate Receptor 4 (IZUMO1R) (NM_001080486) Human Untagged Clone

SKU SC315699

FOLR4 (untagged)-Human folate receptor 4 (delta) homolog (mouse) (FOLR4)

Product Data

• Type: Human Untagged Clone
• Target Symbol: Folate Receptor 4
• Synonyms: folate receptor 4 (delta) homolog; folate receptor 4 (delta) homolog (mouse); Folbp3
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_001080486 edited; GCCACCATGGCATGCTGGTGGCCGCTCCTGCTAGAGCTGTGGACAGTCATGCCCACCTGG; GCTGGGGACGAGCTGCTCAACATCTGCATGAATGCCAAACACCACAAGAGAGTGCCCAGC; CCAGAAGACAAGCTCTATGAGGAGTGCATCCCCTGGAAGGACAATGCCTGCTGCACCCTC; ACGACAAGCTGGGAAGCCCATCTGGATGTATCCCCACTCTACAACTTCAGCCTGTTTCAC; TGTGGACTGCTGATGCCTGGCTGTCGGAAGCACTTCATCCAGGCTATCTGCTTCTATGAG; TGCTCCCCAAACCTGGGGCCCTGGATCCAGCCAGTGGCCCCGAGTGGGCAGGGAGAGCGA; GTTGTGAATGTGCCGCTGTGCCAGGAGGACTGTGAGGAGTGGTGGGAAGACTGTCGCATG; TCTTACACATGCAAATCCAACTGGCGTGGTGGCTGGGACTGGAGTCAGGGGAAGAACCGC; TGCCCCAAAGGGGCCCAGTGCCTCCCTTTCTCCCATTACTTCCCCACCCCAGCTGACCTG; TGTGAGAAGACTTGGAGCAATTCCTTCAAAGCCAGCCCTGAGCGACGGAACAGTGGGCGG; TGTCTCCAGAAGTGGTTTGAGCCTGCTCAGGGCAACCCCAATGTGGCCGTGGCCCGCCTC; TTCGCCAGCTCTGCCCCATCCTGGGAACTGTCCTACACCATCATGGTCTGCTCCCTGTTC; CTGCCGTTCCTTTCCTGA;
• Restriction Sites: Please inquire
• ACCN: NM_001080486
• Insert Size: 700 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001080486.1, NP_001073955.1
• RefSeq Size: 732 bp
• RefSeq ORF: 732 bp
• Locus ID: 390243
• Cytogenetics: 11q21
• Summary: Receptor for IZUMO1 present at the cell surface of oocytes (oolemma), which is essential for species-specific gamete recognition and fertilization. The IZUMO1:IZUMO1R/JUNO interaction is a necessary adhesion event between sperm and egg that is required for fertilization but is not sufficient for cell fusion. The ligand-receptor interaction probably does not act as a membrane 'fusogen'. Does not bind folate.[UniProtKB/Swiss-Prot Function]