MS4A6A (NM_022349) Human Untagged Clone

SKU
SC315408
MS4A6A (untagged)-Human membrane-spanning 4-domains, subfamily A, member 6A (MS4A6A), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MS4A6A
Synonyms 4SPAN3; 4SPAN3.2; CD20L3; CDA01; MS4A6; MST090; MSTP090
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC315408 representing NM_022349.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACATCACAACCTGTTCCCAATGAGACCATCATAGTGCTCCCATCAAATGTCATCAACTTCTCCCAA
GCAGAGAAACCCGAACCCACCAACCAGGGGCAGGATAGCCTGAAGAAACATCTACACGCAGAAATCAAA
GTTATTGGGACTATCCAGATCTTGTGTGGCATGATGGTATTGAGCTTGGGGATCATTTTGGCATCTGCT
TCCTTCTCTCCAAATTTTACCCAAGTGACTTCTACACTGTTGAACTCTGCTTACCCATTCATAGGACCC
TTTTTTTTTATCATCTCTGGCTCTCTATCAATCGCCACAGAGAAAAGGTTAACCAAGCTTTTGGTGCAT
AGCAGCCTGGTTGGAAGCATTCTGAGTGCTCTGTCTGCCCTGGTGGGTTTCATTATCCTGTCTGTCAAA
CAGGCCACCTTAAATCCTGCCTCACTGCAGTGTGAGTTGGACAAAAATAATATACCAACAAGAAGTTAT
GTTTCTTACTTTTATCATGATTCACTTTATACCACGGACTGCTATACAGCCAAAGCCAGTCTGGCTGGA
ACTCTCTCTCTGATGCTGATTTGCACTCTGCTGGAATTCTGCCTAGCTGTGCTCACTGCTGTGCTGCGG
TGGAAACAGGCTTACTCTGACTTCCCTGGGGTGAGTGTGCTGGCCGGCTTCACTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_022349
Insert Size 678 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_022349.3
RefSeq Size 1562 bp
RefSeq ORF 678 bp
Locus ID 64231
UniProt ID Q9H2W1
Cytogenetics 11q12.2
Domains CD20
Protein Families Druggable Genome, Transmembrane
MW 24.3 kDa
Summary This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. The gene encoding this protein is localized to 11q12.1, among a cluster of family members. Alternative splicing of this gene results in several transcript variants that encode different protein isoforms. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (2) is shorter on the 5' end and differs in the 3' end, compared to variant 1. This results in a shorter isoform (2) with a distinct C-terminus, compared to isoform 1.
Write Your Own Review
You're reviewing:MS4A6A (NM_022349) Human Untagged Clone
Your Rating
SKU Description Size Price
RC211112 MS4A6A (Myc-DDK-tagged)-Human membrane-spanning 4-domains, subfamily A, member 6A (MS4A6A), transcript variant 2 10 ug
$300.00
RC211112L1 Lenti ORF clone of Human membrane-spanning 4-domains, subfamily A, member 6A (MS4A6A), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC211112L2 Lenti ORF clone of Human membrane-spanning 4-domains, subfamily A, member 6A (MS4A6A), transcript variant 2, mGFP tagged 10 ug
$600.00
RC211112L3 Lenti ORF clone of Human membrane-spanning 4-domains, subfamily A, member 6A (MS4A6A), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC211112L4 Lenti ORF clone of Human membrane-spanning 4-domains, subfamily A, member 6A (MS4A6A), transcript variant 2, mGFP tagged 10 ug
$600.00
RG211112 MS4A6A (tGFP-tagged) - Human membrane-spanning 4-domains, subfamily A, member 6A (MS4A6A), transcript variant 2 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.