MS4A6A (NM_022349) Human Untagged Clone

CAT#: SC315408

MS4A6A (untagged)-Human membrane-spanning 4-domains, subfamily A, member 6A (MS4A6A), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MS4A6A
• Synonyms: 4SPAN3; 4SPAN3.2; CD20L3; CDA01; MS4A6; MST090; MSTP090
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC315408 representing NM_022349.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGACATCACAACCTGTTCCCAATGAGACCATCATAGTGCTCCCATCAAATGTCATCAACTTCTCCCAA
  GCAGAGAAACCCGAACCCACCAACCAGGGGCAGGATAGCCTGAAGAAACATCTACACGCAGAAATCAAA
  GTTATTGGGACTATCCAGATCTTGTGTGGCATGATGGTATTGAGCTTGGGGATCATTTTGGCATCTGCT
  TCCTTCTCTCCAAATTTTACCCAAGTGACTTCTACACTGTTGAACTCTGCTTACCCATTCATAGGACCC
  TTTTTTTTTATCATCTCTGGCTCTCTATCAATCGCCACAGAGAAAAGGTTAACCAAGCTTTTGGTGCAT
  AGCAGCCTGGTTGGAAGCATTCTGAGTGCTCTGTCTGCCCTGGTGGGTTTCATTATCCTGTCTGTCAAA
  CAGGCCACCTTAAATCCTGCCTCACTGCAGTGTGAGTTGGACAAAAATAATATACCAACAAGAAGTTAT
  GTTTCTTACTTTTATCATGATTCACTTTATACCACGGACTGCTATACAGCCAAAGCCAGTCTGGCTGGA
  ACTCTCTCTCTGATGCTGATTTGCACTCTGCTGGAATTCTGCCTAGCTGTGCTCACTGCTGTGCTGCGG
  TGGAAACAGGCTTACTCTGACTTCCCTGGGGTGAGTGTGCTGGCCGGCTTCACTTAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_022349
• Insert Size: 678 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_022349.3
• RefSeq Size: 1562 bp
• RefSeq ORF: 678 bp
• Locus ID: 64231
• UniProt ID: Q9H2W1
• Cytogenetics: 11q12.2
• Domains: CD20
• Protein Families: Druggable Genome, Transmembrane
• MW: 24.3 kDa
• Gene Summary: This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. The gene encoding this protein is localized to 11q12.1, among a cluster of family members. Alternative splicing of this gene results in several transcript variants that encode different protein isoforms. [provided by RefSeq, Oct 2011]
  Transcript Variant: This variant (2) is shorter on the 5' end and differs in the 3' end, compared to variant 1. This results in a shorter isoform (2) with a distinct C-terminus, compared to isoform 1.