BTN3A1 (NM_007048) Human Untagged Clone

SKU
SC313792
BTN3A1 (untagged)-Human butyrophilin, subfamily 3, member A1 (BTN3A1), transcript variant 1
$718.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol BTN3A1
Synonyms BT3.1; BTF5; BTN3.1; CD277
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_007048 edited
ATGAAAATGGCAAGTTTCCTGGCCTTCCTTCTGCTCAACTTTCGTGTCTGCCTCCTTTTG
CTTCAGCTGCTCATGCCTCACTCAGCTCAGTTTTCTGTGCTTGGACCCTCTGGGCCCATC
CTGGCCATGGTGGGTGAAGACGCTGATCTGCCCTGTCACCTGTTCCCGACCATGAGTGCA
GAGACCATGGAGCTGAAGTGGGTGAGTTCCAGCCTAAGGCAGGTGGTGAACGTGTATGCA
GATGGAAAGGAAGTGGAAGACAGGCAGAGTGCACCGTATCGAGGGAGAACTTCGATTCTG
CGGGATGGCATCACTGCAGGGAAGGCTGCTCTCCGAATACACAACGTCACAGCCTCTGAC
AGTGGAAAGTACTTGTGTTATTTCCAAGATGGTGACTTCTATGAAAAAGCCCTGGTGGAG
CTGAAGGTTGCAGCACTGGGTTCTGATCTTCACGTTGATGTGAAGGGTTACAAGGATGGA
GGGATCCATCTGGAGTGCAGGTCCACTGGCTGGTACCCCCAACCCCAAATACAGTGGAGC
AACAACAAGGGAGAGAACATCCCGACTGTGGAAGCACCTGTGGTTGCAGACGGAGTGGGC
CTGTATGCAGTAGCAGCATCTGTGATCATGAGAGGCAGCTCTGGGGAGGGTGTATCCTGT
ACCATCAGAAGTTCCCTCCTCGGCCTGGAAAAGACAGCCAGCATTTCCATCGCAGACCCC
TTCTTCAGGAGCGCCCAGAGGTGGATCGCCGCCCTGGCAGGGACCCTGCCTGTCTTGCTG
CTGCTTCTTGGGGGAGCCGGTTACTTCCTGTGGCAACAGCAGGAGGAAAAAAAGACTCAG
TTCAGAAAGAAAAAGAGAGAGCAAGAGTTGAGAGAAATGGCATGGAGCACAATGAAGCAA
GAACAAAGCACAAGAGTGAAGCTCCTGGAGGAACTCAGATGGAGAAGTATCCAGTATGCA
TCTCGGGGAGAGAGACATTCAGCCTATAATGAATGGAAAAAGGCCCTCTTCAAGCCTGCG
GATGTGATTCTGGATCCAAAAACAGCAAACCCCATCCTCCTTGTTTCTGAGGACCAGAGG
AGTGTGCAGCGTGCCAAGGAGCCCCAGGATCTGCCAGACAACCCTGAGAGATTTAATTGG
CATTATTGTGTTCTCGGCTGTGAGAGCTTCATATCAGGGAGACATTACTGGGAGGTGGAG
GTAGGGGACAGGAAAGAGTGGCATATAGGGGTGTGCAGTAAGAATGTGCAGAGAAAAGGC
TGGGTCAAAATGACACCTGAGAATGGATTCTGGACTATGGGGCTGACTGATGGGAATAAG
TATCGGACTCTAACTGAGCCCAGAACCAACCTGAAACTTCCTAAGCCCCCTAAGAAAGTG
GGGGTCTTCCTGGACTATGAGACTGGAGATATCTCATTCTACAATGCTGTGGATGGATCG
CATATTCATACTTTCCTGGACGTCTCCTTCTCTGAGGCTCTATATCCTGTTTTCAGAATT
TTGACCTTGGAGCCCACGGCCCTGACTATTTGTCCAGCGTGA
Restriction Sites Please inquire
ACCN NM_007048
Insert Size 3100 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_007048.3, NP_008979.3
RefSeq Size 3422 bp
RefSeq ORF 1542 bp
Locus ID 11119
UniProt ID O00481
Cytogenetics 6p22.2
Domains IG, IGv, PRY, SPRY
Protein Families Druggable Genome, Transmembrane
Summary The butyrophilin (BTN) genes are a group of major histocompatibility complex (MHC)-associated genes that encode type I membrane proteins with 2 extracellular immunoglobulin (Ig) domains and an intracellular B30.2 (PRYSPRY) domain. Three subfamilies of human BTN genes are located in the MHC class I region: the single-copy BTN1A1 gene (MIM 601610) and the BTN2 (e.g., BTN2A1; MIM 613590) and BTN3 (e.g., BNT3A1) genes, which have undergone tandem duplication, resulting in 3 copies of each (summary by Smith et al., 2010 [PubMed 20208008]).[supplied by OMIM, Nov 2010]
Transcript Variant: This variant (1) encodes the longest isoform (a).
Write Your Own Review
You're reviewing:BTN3A1 (NM_007048) Human Untagged Clone
Your Rating
SKU Description Size Price
RC216344 BTN3A1 (Myc-DDK-tagged)-Human butyrophilin, subfamily 3, member A1 (BTN3A1), transcript variant 1 10 ug
$716.00
RC216344L1 Lenti ORF clone of Human butyrophilin, subfamily 3, member A1 (BTN3A1), transcript variant 1, Myc-DDK-tagged 10 ug
$1,016.00
RC216344L2 Lenti ORF clone of Human butyrophilin, subfamily 3, member A1 (BTN3A1), transcript variant 1, mGFP tagged 10 ug
$1,016.00
RC216344L3 Lenti ORF clone of Human butyrophilin, subfamily 3, member A1 (BTN3A1), transcript variant 1, Myc-DDK-tagged 10 ug
$1,016.00
RC216344L4 Lenti ORF clone of Human butyrophilin, subfamily 3, member A1 (BTN3A1), transcript variant 1, mGFP tagged 10 ug
$1,016.00
RG216344 BTN3A1 (tGFP-tagged) - Human butyrophilin, subfamily 3, member A1 (BTN3A1), transcript variant 1 10 ug
$916.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.