HNF6 (ONECUT1) (NM_004498) Human Untagged Clone

CAT#: SC313601

ONECUT1 (untagged)-Human one cut homeobox 1 (ONECUT1)


  "NM_004498" in other vectors (6)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
HNF6 mouse monoclonal antibody, clone OTI4F12 (formerly 4F12)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "HNF6"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HNF6
Synonyms HNF-6; HNF6; HNF6A
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_004498 edited
ATGAACGCGCAGCTGACCATGGAAGCGATCGGCGAGCTGCACGGGGTGAGCCATGAGCCG
GTGCCCGCCCCTGCCGACCTGCTGGGCGGCAGCCCCCACGCGCGCAGCTCCGTGGCGCAC
CGCGGCAGCCACCTGCCCCCCGCGCACCCGCGCTCCATGGGCATGGCGTCCCTGCTGGAC
GGCGGCAGCGGCGGCGGAGATTACCACCACCACCACCGGGCCCCTGAGCACAGCCTGGCC
GGCCCCCTGCATCCCACCATGACCATGGCCTGCGAGACTCCCCCAGGTATGAGCATGCCC
ACCACCTACACCACCTTGACCCCTCTGCAGCCGCTGCCTCCCATCTCCACAGTCTCGGAC
AAGTTCCCCCACCATCACCACCACCACCATCACCACCACCACCCGCACCACCACCAGCGC
CTGGCGGGCAACGTGAGCGGTAGCTTCACGCTCATGCGGGATGAGCGCGGGCTGGCCTCC
ATGAATAACCTCTATACCCCCTACCACAAGGACGTGGCCGGCATGGGCCAGAGCCTCTCG
CCCCTCTCCAGCTCCGGTCTGGGCAGCATCCACAACTCCCAGCAAGGGCTCCCCCACTAT
GCCCACCCGGGGGCCGCCATGCCCACCGACAAGATGCTCACCCCCAACGGCTTCGAAGCC
CACCACCCGGCCATGCTCGGCCGCCACGGGGAGCAGCACCTCACGCCCACCTCGGCCGGC
ATGGTGCCCATCAACGGCCTTCCTCCGCACCATCCCCACGCCCACCTGAACGCCCAGGGC
CACGGGCAACTCCTGGGCACAGCCCGGGAGCCCAACCCTTCGGTGACCGGCGCGCAGGTC
AGCAATGGAAGTAATTCAGGTCAGATGGAAGAGATCAATACCAAAGAGGTGGCGCAGCGT
ATCACCACCGAGCTCAAGCGCTACAGCATCCCACAGGCCATCTTCGCGCAGAGGGTGCTC
TGCCGCTCCCAGGGGACCCTCTCGGACCTGCTGCGCAACCCCAAACCCTGGAGCAAACTC
AAATCCGGCCGGGAGACCTTCCGGAGGATGTGGAAGTGGCTGCAGGAGCCGGAGTTCCAG
CGCATGTCCGCGCTCCGCTTAGCAGCATGCAAAAGGAAAGAACAAGAACATGGGAAGGAT
AGAGGCAACACACCCAAAAAGCCCAGGTTGGTCTTCACAGATGTCCAGCGTCGAACTCTA
CATGCAATATTCAAGGAAAATAAGCGTCCATCCAAAGAATTGCAAATCACCATTTCCCAG
CAGCTGGGGTTGGAGCTGAGCACTGTCAGCAACTTCTTCATGAACGCAAGAAGGAGGAGT
CTGGACAAGTGGCAGGACGAGGGCAGCTCCAATTCAGGCAACTCATCTTCTTCATCAAGC
ACTTGTACCAAAGCATGA
Restriction Sites Please inquire     
ACCN NM_004498
Insert Size 1500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004498.1, NP_004489.1
RefSeq Size 1925 bp
RefSeq ORF 1398 bp
Locus ID 3175
UniProt ID Q9UBC0
Cytogenetics 15q21.3
Protein Families ES Cell Differentiation/IPS, Transcription Factors
Protein Pathways Maturity onset diabetes of the young
Gene Summary This gene encodes a member of the Cut homeobox family of transcription factors. Expression of the encoded protein is enriched in the liver, where it stimulates transcription of liver-expressed genes, and antagonizes glucocorticoid-stimulated gene transcription. This gene may influence a variety of cellular processes including glucose metabolism, cell cycle regulation, and it may also be associated with cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Transcript Variant: This variant (1) represents the longer transcript and encodes the functional protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.