DDI2 (NM_032341) Human Untagged Clone

SKU
SC313304
DDI2 (untagged)-Human DNA-damage inducible 1 homolog 2 (S. cerevisiae) (DDI2)
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol DDI2
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_032341 edited
ATGCTGCTCACCGTGTACTGTGTGCGGAGGGACCTCTCCGAGGTGACCTTTTCCCTCCAG
GTCGACGCCGACTTCGAGCTGCACAACTTCCGCGCGCTGTGCGAGCTCGAGTCTGGCATC
CCCGCAGCCGAGAGCCAGATCGTCTATGCGGAAAGACCTCTCACAGACAACCACAGATCA
TTGGCTTCTTATGGCTTGAAAGATGGGGACGTTGTGATTTTACGACAGAAGGAGAATGCA
GACCCTCGACCTCCAGTGCAGTTCCCAAACTTACCCCGAATAGATTTCAGTAGTATAGCT
GTGCCTGGCACATCAAGTCCCCGGCAGCGCCAGCCACCAGGAACACAGCAGTCCCACTCA
TCTCCTGGAGAAATAACTTCATCTCCTCAGGGCTTGGACAATCCAGCCTTGCTCCGAGAT
ATGTTGCTGGCCAACCCGCATGAGCTGTCCTTGCTGAAGGAACGCAATCCACCCCTGGCA
GAAGCTCTGCTCAGTGGAGACCTTGAGAAATTTTCTAGAGTCCTGGTGGAGCAGCAGCAG
GACCGAGCCCGGAGAGAGCAAGAAAGGATTCGTCTGTTTTCTGCTGATCCCTTTGACCTT
GAAGCTCAGGCAAAGATAGAAGAAGATATAAGGCAACAGAACATTGAGGAAAACATGACA
ATAGCTATGGAAGAGGCTCCGGAAAGTTTTGGCCAAGTAGTGATGCTTTATATTAACTGC
AAAGTGAATGGACATCCTGTGAAAGCCTTTGTTGACTCAGGTGCCCAGATGACTATCATG
AGCCAAGCTTGTGCAGAAAGGTGTAACATAATGAGACTGGTGGACCGTCGGTGGGCAGGG
ATTGCCAAAGGAGTGGGCACCCAGAAGATTATTGGAAGGGTACATCTAGCTCAGGTTCAG
ATTGAAGGAGATTTTTTGCCATGTTCCTTCTCTATACTTGAGGAACAGCCCATGGACATG
CTTCTGGGACTGGACATGCTTAAACGGCACCAGTGTTCCATCGACCTGAAGAAAAATGTA
CTCGTGATCGGCACCACAGGCTCCCAGACCACCTTTCTTCCTGAGGGAGAGCTACCAGAG
TGTGCCCGGTTGGCATATGGGGCTGGAAGAGAGGATGTACGGCTAGAGGAGATTGCAGAC
CAAGAATTAGCAGAAGCCCTTCAAAAATCAGCAGAGGATGCAGAGCGTCAGAAGCCATGA
Restriction Sites NotI-NotI
ACCN NM_032341
Insert Size 6000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this clone has been fully sequenced and found one SNP within the protein associated with this reference, NM_032341.3.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_032341.3, NP_115717.3
RefSeq Size 1759 bp
RefSeq ORF 1200 bp
Locus ID 84301
UniProt ID Q5TDH0
Cytogenetics 1p36.21
Protein Families Druggable Genome
Summary Aspartic protease that mediates the cleavage of NFE2L1/NRF1 at 'Leu-104', thereby promoting release of NFE2L1/NRF1 from the endoplasmic reticulum membrane (PubMed:27676298, PubMed:27528193). Ubiquitination of NFE2L1/NRF1 is a prerequisite for cleavage, suggesting that DDI2 specifically recognizes and binds ubiquitinated NFE2L1/NRF1 (PubMed:27528193). Seems to act as a proteasomal shuttle which links the proteasome and replication fork proteins like RTF2 (Probable). Required, with DDI1, for cellular survival following replication stress. Together or redudantly with DDI1, removes RTF2 from stalled forks to allow cell cycle progression after replication stress and maintains genome integrity (PubMed:29290612).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:DDI2 (NM_032341) Human Untagged Clone
Your Rating
SKU Description Size Price
RC218468 DDI2 (Myc-DDK-tagged)-Human DNA-damage inducible 1 homolog 2 (S. cerevisiae) (DDI2) 10 ug
$289.00 MSRP $457.00 MSRP $457.00
RC218468L3 Lenti ORF clone of Human DNA-damage inducible 1 homolog 2 (S. cerevisiae) (DDI2), Myc-DDK-tagged 10 ug
$757.00
RC218468L4 Lenti ORF clone of Human DNA-damage inducible 1 homolog 2 (S. cerevisiae) (DDI2), mGFP tagged 10 ug
$757.00
RG218468 DDI2 (tGFP-tagged) - Human DNA-damage inducible 1 homolog 2 (S. cerevisiae) (DDI2) 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.