POGZ (NM_145796) Human Untagged Clone

SKU
SC313139
POGZ (untagged)-Human pogo transposable element with ZNF domain (POGZ), transcript variant 3
$503.00
5 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol POGZ
Synonyms MRD37; WHSUS; ZNF280E; ZNF635; ZNF635m
Vector pCMV6 series
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_145796, the custom clone sequence may differ by one or more nucleotides
ATGGCGGACACCGACCTGTTCATGGAATGTGAGGAGGAGGAGTTGGAGCCATGGCAGAAA
ATCAGTGATGTCATTGAGGACTCTGTAGTTGAAGATTATAATTCAGTGGATAAAACTACC
ACAGTTTCTGTGAGCCAGCAGCCAGTCTCGGCTCCAGTGCCCATCGCTGCCCATGCTTCT
GTTGCTGGGCACCTCTCTACATCCACCACCGTTAGTAGCAGCGGGGCACAGAACAGCGAC
AGTACAAAGAAGACTCTTGTCACACTAATTGCCAACAACAATGCTGGCAATCCTTTGGTC
CAGCAAGGTGGACAGCCACTCATCCTGACCCAGAATCCAGCCCCAGGTCTGGGCACAATG
GTTACTCAACCAGTATTGAGGCCTGTTCAGGTCATGCAGAATGCCAATCATGTGACTAGT
TCCCCTGTGGCCTCACAACCAATATTTATCACTACGCAGGGATTTCCTGTAAGGAATGTC
CGGCCTGTACAAAATGCAATGAATCAGGTTGGGATTGTGCTGAACGTACAGCAAGGCCAA
ACGGTTAGACCAATTACACTAGTTCCAGCCCCAGGTACCCAGTTTGTTAAGCCGACAGTT
GGAGTTCCACAAGTGTTCTCCCAGATGACCCCTGTGAGGCCAGGCTCCACAATGCCTGTG
AGGCCCACCACCAACACCTTCACCACCGTCATCCCGGCCACTCTTACCATTCGAAGCACC
GTCCCACAGTCCCAGTCCCAGCAGACCAAGTCCACTCCCAGCACTTCTACCACTCCCACT
GCCACACAGCCAACCTCACTGGGGCAACTAGCTGTTCAGTCTCCAGGCCAGTCAAACCAG
ACCACGAATCCCAAGCTAGCTCCCTCCTTCCCCTCTCCACCTGCAGTGAGCATTGCCAGC
TTTGTCACTGTGAAGCGACCTGGTGTTACAGGCGAAAATAGCAATGAAGTGGCCAAATTG
GTGAATACCCTTAACACCATCCCTTCCCTGGGCCAGAGTCCTGGGCCAGTGGTGGTGTCC
AACAACAGCTCTGCTCATGGCTCTCAAAGAACCAGCGGACCTGAGTCTTCAATGAAAGGT
ACAATAACC
Restriction Sites Please inquire
ACCN NM_145796
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_145796.2, NP_665739.2
RefSeq Size 2239 bp
RefSeq ORF 1092 bp
Locus ID 23126
UniProt ID Q7Z3K3
Cytogenetics 1q21.3
Domains zf-C2H2
Summary The protein encoded by this gene appears to be a zinc finger protein containing a transposase domain at the C-terminus. This protein was found to interact with the transcription factor SP1 in a yeast two-hybrid system. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Aug 2010]
Transcript Variant: This variant (3) lacks two in-frame exons compared to variant 1. The resulting isoform (3) is shorter than isoform 1.
Write Your Own Review
You're reviewing:POGZ (NM_145796) Human Untagged Clone
Your Rating
SKU Description Size Price
RC217850 POGZ (Myc-DDK-tagged)-Human pogo transposable element with ZNF domain (POGZ), transcript variant 3 10 ug
$589.00 MSRP $1,145.00 MSRP $1,145.00
RC217850L3 Lenti-ORF clone of POGZ (Myc-DDK-tagged)-Human pogo transposable element with ZNF domain (POGZ), transcript variant 3 10 ug
$1,445.00
RC217850L4 Lenti-ORF clone of POGZ (mGFP-tagged)-Human pogo transposable element with ZNF domain (POGZ), transcript variant 3 10 ug
$1,445.00
RG217850 POGZ (tGFP-tagged) - Human pogo transposable element with ZNF domain (POGZ), transcript variant 3 10 ug
$1,345.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.