CAMK1D (NM_020397) Human Untagged Clone

SKU
SC313112
CAMK1D (untagged)-Human calcium/calmodulin-dependent protein kinase ID (CAMK1D), transcript variant 1
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CAMK1D
Synonyms CaM-K1; CaMKID; CKLiK
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_020397 edited
ATGGCCCGGGAGAACGGCGAGAGCAGCTCCTCCTGGAAAAAGCAAGCTGAAGACATCAAG
AAGATCTTCGAGTTCAAAGAGACCCTCGGAACCGGGGCCTTTTCCGAAGTGGTTTTAGCT
GAAGAGAAGGCAACTGGCAAGCTCTTTGCTGTGAAGTGTATCCCTAAGAAGGCGCTGAAG
GGCAAGGAAAGCAGCATAGAGAATGAGATAGCCGTCCTGAGAAAGATTAAGCATGAAAAT
ATTGTTGCCCTGGAAGACATTTATGAAAGCCCAAATCACCTGTACTTGGTCATGCAGCTG
GTGTCCGGTGGAGAGCTGTTTGACCGGATAGTGGAGAAGGGGTTTTATACAGAGAAGGAT
GCCAGCACTCTGATCCGCCAAGTCTTGGACGCCGTGTACTATCTCCACAGAATGGGCATC
GTCCACAGAGACCTCAAGCCCGAAAATCTCTTGTACTACAGTCAAGATGAGGAGTCCAAA
ATAATGATCAGTGACTTTGGATTGTCAAAAATGGAGGGCAAAGGAGATGTGATGTCCACT
GCCTGTGGAACTCCAGGCTATGTCGCTCCTGAAGTCCTCGCCCAGAAACCTTACAGCAAA
GCCGTTGACTGCTGGTCCATCGGAGTGATTGCCTACATCTTGCTCTGCGGCTACCCTCCT
TTTTATGATGAAAATGACTCCAAGCTCTTTGAGCAGATCCTCAAGGCGGAATATGAGTTT
GACTCTCCCTACTGGGATGACATCTCCGACTCTGCAAAAGACTTCATTCGGAACCTGATG
GAGAAGGACCCGAATAAAAGATACACGTGTGAGCAGGCAGCTCGGCACCCATGGATCGCT
GGTGACACAGCCCTCAACAAAAACATCCACGAGTCCGTCAGCGCCCAGATCCGGAAAAAC
TTTGCCAAGAGCAAATGGAGACAAGCATTTAATGCCACGGCCGTCGTCAGACATATGAGA
AAACTACACCTCGGCAGCAGCCTGGACAGTTCAAATGCAAGTGTTTCGAGCAGCCTCAGT
TTGGCCAGCCAAAAAGACTGTGCGTATGTAGCAAAACCAGAATCCCTCAGCTGA
Restriction Sites Please inquire
ACCN NM_020397
Insert Size 1300 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_020397.2, NP_065130.1
RefSeq Size 1727 bp
RefSeq ORF 1074 bp
Locus ID 57118
UniProt ID Q8IU85
Cytogenetics 10p13
Protein Families Druggable Genome, Protein Kinase
Summary This gene is a member of the calcium/calmodulin-dependent protein kinase 1 family, a subfamily of the serine/threonine kinases. The encoded protein is a component of the calcium-regulated calmodulin-dependent protein kinase cascade. It has been associated with multiple processes including regulation of granulocyte function, activation of CREB-dependent gene transcription, aldosterone synthesis, differentiation and activation of neutrophil cells, and apoptosis of erythroleukemia cells. Alternatively spliced transcript variants encoding different isoforms of this gene have been described. [provided by RefSeq, Jan 2015]
Transcript Variant: This variant (1) lacks the 3' terminal exon used in variant 2, and its 3' terminal exon extends past a splice site that is used in variant 2. It encodes isoform 1, which has a shorter and distinct C-terminus, compared to isoform 2.
Write Your Own Review
You're reviewing:CAMK1D (NM_020397) Human Untagged Clone
Your Rating
SKU Description Size Price
RC217129 CAMK1D (Myc-DDK-tagged)-Human calcium/calmodulin-dependent protein kinase ID (CAMK1D), transcript variant 1 10 ug
$457.00
RC217129L3 Lenti ORF clone of Human calcium/calmodulin-dependent protein kinase ID (CAMK1D), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC217129L4 Lenti ORF clone of Human calcium/calmodulin-dependent protein kinase ID (CAMK1D), transcript variant 1, mGFP tagged 10 ug
$757.00
RG217129 CAMK1D (tGFP-tagged) - Human calcium/calmodulin-dependent protein kinase ID (CAMK1D), transcript variant 1 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.