ZDHHC20 (NM_153251) Human Untagged Clone

CAT#: SC313098

ZDHHC20 (untagged)-Human zinc finger, DHHC-type containing 20 (ZDHHC20)


  "NM_153251" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


ZDHHC20 rabbit polyclonal antibody
    • 100 ul

USD 380.00

Other products for "ZDHHC20"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ZDHHC20
Synonyms 4933421L13Rik; DHHC-20; DHHC20
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC313098 representing NM_153251.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGCCCTGGACGCTGTGGCGCTGCTGCCAGCGCGTCGTGGGCTGGGTGCCGGTGCTCTTCATCACC
TTCGTGGTCGTCTGGTCCTACTACGCGTACGTGGTGGAGCTCTGCGTGTTTACTATTTTTGGAAATGAA
GAAAATGGAAAGACCGTTGTTTACCTTGTGGCTTTCCATCTGTTCTTTGTTATGTTTGTATGGTCCTAT
TGGATGACAATTTTCACATCTCCCGCTTCCCCCTCCAAAGAGTTCTACTTGTCCAATTCTGAAAAGGAA
CGTTATGAAAAAGAATTCAGCCAAGAAAGACAACAAGAAATTTTGAGAAGAGCAGCAAGAGCTTTACCT
ATCTATACCACATCAGCTTCAAAAACTATCAGATATTGTGAAAAATGTCAGCTGATTAAACCTGATCGG
GCGCATCACTGCTCAGCCTGTGACTCATGTATTCTTAAGATGGATCATCACTGTCCTTGGGTGAATAAC
TGTGTGGGATTTTCTAATTACAAATTCTTCCTGCTGTTTTTATTGTATTCCCTATTATATTGCCTTTTC
GTGGCTGCAACAGTTTTAGAGTACTTTATAAAATTTTGGACGAATGAACTGACAGATACACGTGCAAAA
TTCCACGTACTTTTTCTTTTCTTTGTGTCTGCAATGTTCTTCATCAGCGTCCTCTCACTTTTCAGCTAC
CACTGCTGGCTAGTTGGAAAAAATAGAACAACAATAGAATCATTCCGCGCACCCACGTTTTCATACGGA
CCTGATGGAAATGGTTTCTCTCTTGGATGCAGTAAAAATTGGAGACAAGTCTTTGGTGATGAAAAGAAA
TATTGGCTACTTCCAATATTTTCAAGCTTGGGTGATGGTTGCAGTTTTCCAACTCGCCTTGTGGGGATG
GATCCAGAACAAGCTTCTGTTACAAACCAGAATGAGTATGCCAGAAGTGGCTCAAATCAACCTTTTCCT
ATCAAACCACTTAGTGAATCAAAAAACCGCTTGTTGGACAGTGAATCTCAGTGGCTGGAGAATGGAGCT
GAAGAAGGCATCGTCAAATCAGGTGTATGA

AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT
ATCCTGGATTACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_153251
Insert Size 1065 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_153251.3
RefSeq Size 5356 bp
RefSeq ORF 1065 bp
Locus ID 253832
UniProt ID Q5W0Z9
Cytogenetics 13q12.11
Protein Families Transmembrane
MW 41.1 kDa
Gene Summary Catalyzes palmitoylation of Cys residues on target proteins (PubMed:27153536, PubMed:29326245). Catalyzes palmitoylation of Cys residues in the cytoplasmic C-terminus of EGFR, and modulates the duration of EGFR signaling by modulating palmitoylation-dependent EGFR internalization and degradation (PubMed:27153536). Has a preference for acyl-CoA with C16 fatty acid chains (PubMed:29326245). Can also utilize acyl-CoA with C14 and C18 fatty acid chains (PubMed:29326245).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.