hnRNP A2B1 (HNRNPA2B1) (NM_031243) Human Untagged Clone

SKU
SC313092
HNRNPA2B1 (untagged)-Human heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1), transcript variant B1
$686.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol hnRNP A2B1
Synonyms HNRNPA2; HNRNPB1; HNRPA2; HNRPA2B1; HNRPB1; IBMPFD2; RNPA2; SNRPB1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_031243 edited
ATGGAGAAAACTTTAGAAACTGTTCCTTTGGAGAGGAAAAAGAGAGAAAAGGAACAGTTC
CGTAAGCTCTTTATTGGTGGCTTAAGCTTTGAAACCACAGAAGAAAGTTTGAGGAACTAC
TACGAACAATGGGGAAAGCTTACAGACTGTGTGGTAATGAGGGATCCTGCAAGCAAAAGA
TCAAGAGGATTTGGTTTTGTAACTTTTTCATCCATGGCTGAGGTTGATGCTGCCATGGCT
GCAAGACCTCATTCAATTGATGGGAGAGTAGTTGAGCCAAAACGTGCTGTAGCAAGAGAG
GAATCTGGAAAACCAGGGGCTCATGTAACTGTGAAGAAGCTGTTTGTTGGCGGAATTAAA
GAAGATACTGAGGAACATCACCTTAGAGATTACTTTGAGGAATATGGAAAAATTGATACC
ATTGAGATAATTACTGATAGGCAGTCTGGAAAGAAAAGAGGCTTTGGCTTTGTTACTTTT
GATGACCATGATCCTGTGGATAAAATCGTATTGCAGAAATACCATACCATCAATGGTCAT
AATGCAGAAGTAAGAAAGGCTTTGTCTAGACAAGAAATGCAGGAAGTTCAGAGTTCTAGG
AGTGGAAGAGGAGGCAACTTTGGCTTTGGGGATTCACGTGGTGGCGGTGGAAATTTCGGA
CCAGGACCAGGAAGTAACTTTAGAGGAGGATCTGATGGATATGGCAGTGGACGTGGATTT
GGGGATGGCTATAATGGGTATGGAGGAGGACCTGGAGGTGGCAATTTTGGAGGTAGCCCC
GGTTATGGAGGAGGAAGAGGAGGATATGGTGGTGGAGGACCTGGATATGGCAACCAGGGT
GGGGGCTACGGAGGTGGTTATGACAACTATGGAGGAGGAAATTATGGAAGTGGAAATTAC
AATGATTTTGGAAATTATAACCAGCAACCTTCTAACTACGGTCCAATGAAGAGTGGAAAC
TTTGGTGGTAGCAGGAACATGGGGGGACCATATGGTGGAGGAAACTATGGTCCAGGAGGC
AGTGGAGGAAGTGGGGGTTATGGTGGGAGGAGCCGATACTGA
Restriction Sites Please inquire
ACCN NM_031243
Insert Size 1600 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_031243.1, NP_112533.1
RefSeq Size 1780 bp
RefSeq ORF 1062 bp
Locus ID 3181
UniProt ID P22626
Cytogenetics 7p15.2
Domains RRM
Protein Families Druggable Genome
Summary This gene belongs to the A/B subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two repeats of quasi-RRM domains that bind to RNAs. This gene has been described to generate two alternatively spliced transcript variants which encode different isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (B1) contains an additional 36 bases compared to variant A2. This additional region affects only the beginning of the coding region. The N-terminus of isoform B1 is thus different from isoform A2.
Write Your Own Review
You're reviewing:hnRNP A2B1 (HNRNPA2B1) (NM_031243) Human Untagged Clone
Your Rating
SKU Description Size Price
RC224241 HNRNPA2B1 (Myc-DDK-tagged)-Human heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1), transcript variant B1 10 ug
$289.00 MSRP $686.00 MSRP $686.00
RC224241L1 Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1), transcript variant B1, Myc-DDK-tagged 10 ug
$986.00
RC224241L2 Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1), transcript variant B1, mGFP tagged 10 ug
$986.00
RC224241L3 Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1), transcript variant B1, Myc-DDK-tagged 10 ug
$986.00
RC224241L4 Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1), transcript variant B1, mGFP tagged 10 ug
$986.00
RG224241 HNRNPA2B1 (tGFP-tagged) - Human heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1), transcript variant B1 10 ug
$489.00 MSRP $886.00 MSRP $886.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.