NCBP2 (NM_001042540) Human Untagged Clone

SKU
SC311340
NCBP2 (untagged)-Human nuclear cap binding protein subunit 2, 20kDa (NCBP2), transcript variant 2
$165.00
4 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NCBP2
Synonyms CBC2; CBP20; NIP1; PIG55
Vector pCMV6 series
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001042540, the custom clone sequence may differ by one or more nucleotides
ATGTCGGGTGGCCTCCTGAAGGCGCTGCGCAGCGACTCCTACGTGGAGCTGAGCCAGTAC
CGGGACCAGCACTTCCGGGGTGACAATGAAGAACAAGAAAAATTACTGAAGAAAAGCTAT
GCGGAAAACGCCATGCGGTACATAAATGGGACGCGTCTGGATGACCGAATCATTCGCACA
GACTGGGACGCAGGCTTTAAGGAGGGCAGGCAATACGGCCGTGGGCGATCTGGGGGCCAG
GTTCGGGATGAGTATCGGCAGGACTACGATGCTGGGAGAGGAGGCTATGGAAAACTGGCA
CAGAACCAGTGA
Restriction Sites Please inquire
ACCN NM_001042540
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001042540.1, NP_001036005.1
RefSeq Size 2016 bp
RefSeq ORF 312 bp
Locus ID 22916
UniProt ID P52298
Cytogenetics 3q29
Protein Families Druggable Genome
Protein Pathways Spliceosome
Summary The product of this gene is a component of the nuclear cap-binding protein complex (CBC), which binds to the monomethylated 5' cap of nascent pre-mRNA in the nucleoplasm. The encoded protein has an RNP domain commonly found in RNA binding proteins, and contains the cap-binding activity. The CBC promotes pre-mRNA splicing, 3'-end processing, RNA nuclear export, and nonsense-mediated mRNA decay. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. The encoded isoform (2) is shorter compared to isoform 1.
Write Your Own Review
You're reviewing:NCBP2 (NM_001042540) Human Untagged Clone
Your Rating
SKU Description Size Price
RC221605 NCBP2 (Myc-DDK-tagged)-Human nuclear cap binding protein subunit 2, 20kDa (NCBP2), transcript variant 2 10 ug
$289.00
RC221605L1 Lenti-ORF clone of NCBP2 (Myc-DDK-tagged)-Human nuclear cap binding protein subunit 2, 20kDa (NCBP2), transcript variant 2 10 ug
$450.00
RC221605L2 Lenti-ORF clone of NCBP2 (mGFP-tagged)-Human nuclear cap binding protein subunit 2, 20kDa (NCBP2), transcript variant 2 10 ug
$450.00
RC221605L3 Lenti-ORF clone of NCBP2 (Myc-DDK-tagged)-Human nuclear cap binding protein subunit 2, 20kDa (NCBP2), transcript variant 2 10 ug
$450.00
RC221605L4 Lenti-ORF clone of NCBP2 (mGFP-tagged)-Human nuclear cap binding protein subunit 2, 20kDa (NCBP2), transcript variant 2 10 ug
$450.00
RG221605 NCBP2 (tGFP-tagged) - Human nuclear cap binding protein subunit 2, 20kDa (NCBP2), transcript variant 2 10 ug
$350.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.