CPNE1 (NM_152925) Human Untagged Clone

SKU
SC311288
CPNE1 (untagged)-Human copine I (CPNE1), transcript variant 1
$801.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CPNE1
Synonyms COPN1; CPN1
Vector pCMV6 series
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_152925, the custom clone sequence may differ by one or more nucleotides
ATGGCCCACTGCGTGACCTTGGTTCAGCTGTCCATTTCCTGTGACCATCTCATTGACAAG
GACATCGGCTCCAAGTCTGACCCACTCTGCGTCCTTTTACAGGATGTGGGAGGGGGCAGC
TGGGCTGAGCTTGGCCGGACTGAACGGGTGCGGAACTGCTCAAGCCCTGAGTTCTCCAAG
ACTCTACAGCTTGAGTACCGCTTTGAGACAGTCCAGAAGCTACGCTTTGGAATCTATGAC
ATAGACAACAAGACGCCAGAGCTGAGGGATGATGACTTCCTAGGGGGTGCTGAGTGTTCC
CTAGGACAGATTGTGTCCAGCCAGGTACTGACTCTCCCCTTGATGCTGAAGCCTGGAAAA
CCTGCTGGGCGGGGGACCATCACGGTCTCAGCTCAGGAATTAAAGGACAATCGTGTAGTA
ACCATGGAGGTAGAGGCCAGAAACCTAGATAAGAAGGACTTCCTGGGAAAATCAGATCCA
TTTCTGGAGTTCTTCCGCCAGGGTGATGGGAAATGGCACCTGGTGTACAGATCTGAGGTC
ATCAAGAACAACCTGAACCCTACATGGAAGCGTTTCTCAGTCCCCGTTCAGCATTTCTGT
GGTGGGAACCCCAGCACACCCATCCAGGTGCAATGCTCCGATTATGACAGTGACGGGTCA
CATGATCTCATCGGTACCTTCCACACCAGCTTGGCCCAGCTGCAGGCAGTCCCGGCTGAG
TTTGAATGCATCCACCCTGAGAAGCAGCAGAAAAAGAAAAGCTACAAGAACTCTGGAACT
ATCCGTGTCAAGATTTGTCGGGTAGAAACAGAGTACTCCTTTCTGGACTATGTGATGGGA
GGCTGTCAGATCAACTTCACTGTGGGCGTGGACTTCACTGGCTCCAATGGAGACCCCTCC
TCACCTGACTCCCTACACTACCTGAGTCCAACAGGGGTCAATGAGTACCTGATGGCACTG
TGGAGTGTGGGCAGCGTGGTTCAGGACTATGACTCAGACAAGCTGTTCCCTGCATTTGGA
TTTGGGGCCCAGGTTCCCCCTGACTGGCAGGTCTCGCATGAATTTGCCTTGAATTTCAAC
CCCAGTAACCCCTACTGTGCAGGCATCCAGGGCATTGTGGATGCCTACCGCCAAGCCCTG
CCCCAAGTTCGCCTCTATGGCCCTACCAACTTTGCACCCATCATCAACCATGTGGCCAGG
TTTGCAGCCCAGGCTGCACATCAGGGGACTGCCTCGCAATACTTCATGCTGTTGCTGCTG
ACTGATGGTGCTGTGACGGATGTGGAAGCCACACGTGAGGCTGTGGTGCGTGCCTCGAAC
CTGCCCATGTCAGTGATCATTGTGGGTGTGGGTGGTGCTGACTTTGAGGCCATGGAGCAG
CTGGACGCTGATGGTGGACCCCTGCATACACGTTCTGGGCAGGCTGCTGCCCGCGACATT
GTGCAGTTTGTACCCTACCGCCGGTTCCAGAATGCCCCTCGGGAGGCATTGGCACAGACC
GTGCTCGCAGAAGTGCCCACACAACTGGTCTCATACTTCAGGGCCCAGGGTTGGGCCCCG
CTCAAGCCACTTCCACCCTCAGCCAAGGATCCTGCACAGGCCCCCCAGGCCTAG
Restriction Sites Please inquire
ACCN NM_152925
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_152925.1, NP_690902.1
RefSeq Size 1996 bp
RefSeq ORF 1614 bp
Locus ID 8904
UniProt ID Q99829
Cytogenetics 20q11.22
Domains C2, VWA
Summary Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. This gene encodes a calcium-dependent protein that also contains two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus. However, the encoded protein does not contain a predicted signal sequence or transmembrane domains. This protein has a broad tissue distribution and it may function in membrane trafficking. This gene and the gene for RNA binding motif protein 12 overlap at map location 20q11.21. Alternate splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Aug 2008]
Transcript Variant: This variant (1) is the predominant transcript. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:CPNE1 (NM_152925) Human Untagged Clone
Your Rating
SKU Description Size Price
RC212892 CPNE1 (Myc-DDK-tagged)-Human copine I (CPNE1), transcript variant 1 10 ug
$800.00
RC212892L3 Lenti-ORF clone of CPNE1 (Myc-DDK-tagged)-Human copine I (CPNE1), transcript variant 1 10 ug
$1,100.00
RC212892L4 Lenti-ORF clone of CPNE1 (mGFP-tagged)-Human copine I (CPNE1), transcript variant 1 10 ug
$1,100.00
RG212892 CPNE1 (tGFP-tagged) - Human copine I (CPNE1), transcript variant 1 10 ug
$1,000.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.