AJAP1 (NM_001042478) Human Untagged Clone

SKU
SC311268
AJAP1 (untagged)-Human adherens junctions associated protein 1 (AJAP1), transcript variant 2
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol AJAP1
Synonyms MOT8; SHREW-1; SHREW1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC311268 representing NM_001042478.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTGGATTCAACAGCTTTTAGGACTCAGCTCCATGTCCATCCGCTGGCCGGGCCGCCCCCTCGGAAGC
CATGCCTGGATACTGATAGCCATGTTTCAGCTCGCCGTGGACCTGCCCGCCTGTGAGGCCCTGGGCCCG
GGGCCGGAGTTCTGGCTCCTGCCGCGGTCGCCGCCCCGGCCGCCCCGGCTGTGGAGTTTTAGGAGTGGA
CAGCCAGCGCGGGTCCCGGCCCCGGTGTGGAGCCCCCGGCCGCCCCGAGTGGAGCGGATCCACGGGCAG
ATGCAGATGCCTCGAGCCAGACGGGCCCACAGGCCCCGGGACCAGGCGGCCGCCCTCGTGCCCAAGGCA
GGACTGGCCAAGCCCCCAGCTGCTGCCAAATCCAGCCCTTCCCTCGCCTCTTCGTCCTCGTCCTCGTCC
TCCGCGGTGGCCGGTGGGGCCCCGGAGCAGCAGGCCCTCCTGAGGAGGGGCAAGAGGCACCTGCAGGGG
GACGGTCTCAGCAGCTTCGACTCCAGAGGCAGCCGGCCCACCACAGAGACTGAGTTCATCGCCTGGGGG
CCCACGGGGGACGAGGAGGCCCTGGAGTCCAACACATTTCCGGGCGTTTACGGCCCCACCACGGTCTCC
ATCCTACAAACACGGAAGACAACTGTGGCCGCCACCACCACCACCACCACCACGGCCACCCCCATGACG
CTGCAGACTAAGGGGTTCACCGAGTCCTTGGATCCCCGGAGAAGGATCCCAGGTGGGGTTAGCACAACG
GAGCCTTCCACCAGTCCCAGCAACAACGGGGAAGTCACCCAGCCCCCAAGGATTCTGGGGGAGGCCTCA
GGTCTGGCTGTCCATCAGATCATCACCATCACCGTCTCCCTCATCATGGTCATAGCTGCTCTCATCACA
ACTCTTGTCTTAAAAAATTGCTGTGCCCAAAGCGGGAACACTCGTCGGAACAGCCACCAGCGGAAGACC
AACCAGCAGGAGGAGAGCTGCCAGAACCTCACGGACTTCCCCTCGGCCCGGGTGCCCAGCAGCCTGGAC
ATATTCACGGCCTATAACGAGACCCTGCAGTGTTCTCACGAGTGCGTCAGGGCATCTGTGCCCGTGTAC
ACCGATGAGACGCTGCACTCGACGACGGGGGAGTACAAATCCACATTTAATGGAAACCGACCCTCCTCT
TCTGATCGGCATCTTATTCCTGTGGCCTTCGTGTCTGAGAAATGGTTTGAAATCTCCTGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001042478
Insert Size 1236 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001042478.1
RefSeq Size 2070 bp
RefSeq ORF 1236 bp
Locus ID 55966
UniProt ID Q9UKB5
Cytogenetics 1p36.32
Protein Families Druggable Genome, Transmembrane
MW 44.5 kDa
Summary Plays a role in cell adhesion and cell migration.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 3' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. CCDS Note: This CCDS ID represents the protein described in PMIDs: 14595118 and 17267690. This protein is encoded by two different splice variants that are supported by AF175409.1 and AL049673.1. It should be noted that this transcript is predicted to undergo nonsense-mediated mRNA decay (NMD). However, the protein is represented because it was detected endogenously in PMID: 14595118. It is likely that the majority of transcripts representing this variant will undergo NMD, while some low level of NMD escape may allow for the expression of this protein.
Write Your Own Review
You're reviewing:AJAP1 (NM_001042478) Human Untagged Clone
Your Rating
SKU Description Size Price
RC223102 AJAP1 (Myc-DDK-tagged)-Human adherens junctions associated protein 1 (AJAP1), transcript variant 2 10 ug
$289.00 MSRP $457.00 MSRP $457.00
RC223102L3 Lenti ORF clone of Human adherens junctions associated protein 1 (AJAP1), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC223102L4 Lenti ORF clone of Human adherens junctions associated protein 1 (AJAP1), transcript variant 2, mGFP tagged 10 ug
$757.00
RG223102 AJAP1 (tGFP-tagged) - Human adherens junctions associated protein 1 (AJAP1), transcript variant 2 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.