CD83 (NM_001040280) Human Untagged Clone

SKU
SC310981
CD83 (untagged)-Human CD83 molecule (CD83), transcript variant 2
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CD83
Synonyms BL11; HB15
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_001040280 edited
ATGTCGCGCGGCCTCCAGCTTCTGCTCCTGAGCTGCGCCTACAGCCTGGCTCCCGCGACG
CCGGAGGTGAAGGTGGCTTGCTCCGAAGATGTGGACTTGCCCTGCACCGCCCCCTGGGAT
CCGCAGGTTCCCTACACGGTCTCCTGGGTCAAGTTATTGGAGGGTGGTGAAGAGAGGATG
GAGACACCCCAGGAAGACCACCTCAGAGGACAGCACTATCATCAGAAGGGGCAAAATGGT
TCTTTCGACGCCCCCAATGAAAGGCCCTATTCCCTGAAGATCCGAAACACTACCAGCTGC
AACTCGGGGACATACAGGTGCACTCTGCAGGACCCGGATGGGCAGAGAAACCTAAGTGGC
AAGGTGATCTTGAGAGTGACAGGATGCCCTGCACAGCGTAAAGAAGAGACTTTTAAGAAA
TACAGAGCGGAGATTGTCCTGCTGCTGGCTCTGGTTATTTTCTACTTAACACTCATCATT
TTCACTTGTTTTGCACGGCTACAGAGTATCTTCCCAGATTTTTCTAAAGCTGGCATGGAA
CGAGCTTTTCTCCCAGTTACCTCCCCAAATAAGCATTTAGGGCTAGTGACTCCTCACAAG
ACAGAACTGGTATGA
Restriction Sites Please inquire
ACCN NM_001040280
Insert Size 2100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001040280.1, NP_001035370.1
RefSeq Size 2475 bp
RefSeq ORF 615 bp
Locus ID 9308
UniProt ID Q01151
Cytogenetics 6p23
Protein Families Transmembrane
Summary The protein encoded by this gene is a single-pass type I membrane protein and member of the immunoglobulin superfamily of receptors. The encoded protein may be involved in the regulation of antigen presentation. A soluble form of this protein can bind to dendritic cells and inhibit their maturation. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (2) uses an alternate in-frame splice junction at the 5' end of an exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is 1 aa shorter compared to isoform a.
Write Your Own Review
You're reviewing:CD83 (NM_001040280) Human Untagged Clone
Your Rating
SKU Description Size Price
RC212520 CD83 (Myc-DDK-tagged)-Human CD83 molecule (CD83), transcript variant 2 10 ug
$300.00
RC212520L3 Lenti ORF clone of Human CD83 molecule (CD83), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC212520L4 Lenti ORF clone of Human CD83 molecule (CD83), transcript variant 2, mGFP tagged 10 ug
$600.00
RG212520 CD83 (tGFP-tagged) - Human CD83 molecule (CD83), transcript variant 2 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.