FABP6 (NM_001040442) Human Untagged Clone
SKU
SC310721
FABP6 (untagged)-Human fatty acid binding protein 6, ileal (FABP6), transcript variant 1
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | FABP6 |
Synonyms | I-15P; I-BABP; I-BALB; I-BAP; ILBP; ILBP3; ILLBP |
Vector | pCMV6 series |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_001040442, the custom clone sequence may differ by one or more nucleotides
ATGAAGACAGTGACGATGATGATGGTGGTGGAGATGCAGGCGCTGACTCAGGTTCTGAGA GCTGTGTTGTCTGCGTGCACATGGGTGAGCCGGAAAGGAGACCTGCAGAGAATGAAACAG ACACATAAAGGAAAGCCTCCCAGCAGCATGGCTTTCACCGGCAAGTTCGAGATGGAGAGT GAGAAGAATTATGATGAGTTCATGAAGCTCCTTGGGATCTCCAGCGATGTAATCGAAAAG GCCCGCAACTTCAAGATCGTCACGGAGGTGCAGCAGGATGGGCAGGACTTCACTTGGTCC CAGCACTACTCCGGGGGCCACACCATGACCAACAAGTTCACTGTTGGCAAGGAAAGCAAC ATACAGACAATGGGGGGCAAGACGTTCAAGGCCACTGTGCAGATGGAGGGCGGGAAGCTG GTGGTGAATTTCCCCAACTATCACCAGACCTCAGAGATCGTGGGTGACAAGCTGGTGGAG GTCTCCACCATCGGAGGCGTGACCTATGAGCGCGTGAGCAAGAGACTGGCCTAA |
Restriction Sites | Please inquire |
ACCN | NM_001040442 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001040442.1, NP_001035532.1 |
RefSeq Size | 672 bp |
RefSeq ORF | 534 bp |
Locus ID | 2172 |
UniProt ID | P51161 |
Cytogenetics | 5q33.3 |
Protein Pathways | PPAR signaling pathway |
Summary | This gene encodes the ileal fatty acid binding protein. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABP6 and FABP1 (the liver fatty acid binding protein) are also able to bind bile acids. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. Transcript variants generated by alternate transcription promoters and/or alternate splicing have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) encodes the longer protein (isoform 1). |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC213969 | FABP6 (Myc-DDK-tagged)-Human fatty acid binding protein 6, ileal (FABP6), transcript variant 1 | 10 ug |
$330.00
|
|
RC213969L3 | Lenti-ORF clone of FABP6 (Myc-DDK-tagged)-Human fatty acid binding protein 6, ileal (FABP6), transcript variant 1 | 10 ug |
$630.00
|
|
RC213969L4 | Lenti-ORF clone of FABP6 (mGFP-tagged)-Human fatty acid binding protein 6, ileal (FABP6), transcript variant 1 | 10 ug |
$630.00
|
|
RG213969 | FABP6 (tGFP-tagged) - Human fatty acid binding protein 6, ileal (FABP6), transcript variant 1 | 10 ug |
$530.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.