PRX (NM_020956) Human Untagged Clone

SKU SC310666

PRX (untagged)-Human periaxin (PRX), transcript variant 1

Product Data

• Type: Human Untagged Clone
• Target Symbol: PRX
• Synonyms: CMT4F
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC310666 representing NM_020956.; Blue=Insert sequence Red=Cloning site Green=Tag(s); ; GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG; GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC; ATGGAGGCCAGGAGCCGGAGTGCCGAGGAGCTGAGGCGGGCGGAGTTGGTGGAAATTATCGTGGAGACG; GAGGCGCAGACCGGGGTCAGCGGCATCAACGTAGCGGGCGGCGGCAAAGAGGGAATCTTCGTTCGGGAG; CTGCGCGAGGACTCACCCGCCGCCAGGAGCCTCAGCCTGCAGGAAGGGGACCAGCTGCTGAGTGCCCGA; GTGTTCTTCGAGAACTTCAAGTACGAGGACGCACTACGCCTGCTGCAATGCGCCGAGCCTTACAAAGTC; TCCTTCTGCCTGAAGCGCACTGTGCCCACCGGGGACCTGGCTCTGCGGCCCGGGACCGTGTCTGGCTAC; GAGATCAAGGGCCCGCGGGCCAAGGTGGCCAAGCTGGTACGCGTGCTTAGCCCGGCCCCGGCCCTGGAC; TGCCCCAGCGATCCGGTCTCTGCGCCGTGA; AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT; ATCCTGGATTACAAGGATGACGACGATAAGGTTTAA;
• Restriction Sites: SgfI-RsrII
• ACCN: NM_020956
• Insert Size: 444 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_020956.2
• RefSeq Size: 5533 bp
• RefSeq ORF: 444 bp
• Locus ID: 57716
• UniProt ID: Q9BXM0
• Cytogenetics: 19q13.2
• Protein Families: Druggable Genome
• MW: 15.9 kDa
• Summary: This gene encodes a protein involved in peripheral nerve myelin upkeep. The encoded protein contains 2 PDZ domains which were named after PSD95 (post synaptic density protein), DlgA (Drosophila disc large tumor suppressor), and ZO1 (a mammalian tight junction protein). Two alternatively spliced transcript variants have been described for this gene which encode different protein isoforms and which are targeted differently in the Schwann cell. Mutations in this gene cause Charcot-Marie-Tooth neuoropathy, type 4F and Dejerine-Sottas neuropathy. [provided by RefSeq, Jul 2008]; Transcript Variant: This variant (1) retains an intron in the 3' coding region, which results in a frameshift and an early stop codon, compared to variant 2. The encoded protein (isoform 2) is much shorter and has a distinct C-terminus compared to isoform 2. It is found throughout the Schwann cell cytoplasm. Isoform 1 is also known as S-periaxin.