NUCKS1 (NM_022731) Human Untagged Clone

SKU
SC310605
NUCKS1 (untagged)-Human nuclear casein kinase and cyclin-dependent kinase substrate 1 (NUCKS1)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NUCKS1
Synonyms JC7; NUCKS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC310605 representing NM_022731.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCGCGGCCTGTCAGAAATAGGAAGGTTGTTGATTACTCACAGTTTCAGGAATCTGATGATGCAGAT
GAAGATTATGGAAGAGATTCGGGCCCTCCCACTAAGAAAATTCGATCATCTCCCCGAGAAGCTAAAAAT
AAGAGGCGATCTGGAAAGAATTCACAGGAAGATAGTGAGGACTCAGAAGACAAAGATGTGAAGACCAAG
AAGGATGATTCTCACTCAGCAGAGGATAGTGAAGATGAAAAAGAAGATCATAAAAATGTGCGCCAACAA
CGGCAGGCGGCATCTAAAGCAGCTTCTAAACAGAGAGAGATGCTCATGGAAGATGTGGGCAGTGAGGAA
GAACAAGAAGAGGAGGATGAGGCACCATTCCAGGAGAAAGATTCCGGCAGCGATGAAGATTTCCTAATG
GAAGATGATGACGATAGTGACTATGGCAGTTCGAAAAAGAAAAACAAAAAGATGGTTAAGAAGTCCAAA
CCTGAAAGAAAAGAAAAGAAAATGCCCAAACCCAGACTAAAGGCTACAGTGACGCCAAGTCCAGTGAAA
GGCAAAGGGAAAGTGGGTCGCCCCACAGCTTCAAAGGCATCAAAGGAAAAGACTCCTTCTCCCAAAGAA
GAAGATGAGGAACCGGAAAGCCCGCCAGAAAAGAAAACATCTACAAGCCCCCCACCCGAGAAATCTGGG
GATGAAGGGTCTGAAGATGAAGCCCCTTCTGGGGAGGATTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_022731
Insert Size 732 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_022731.4
RefSeq Size 6471 bp
RefSeq ORF 732 bp
Locus ID 64710
UniProt ID Q9H1E3
Cytogenetics 1q32.1
Protein Families Druggable Genome
MW 27.3 kDa
Summary This gene encodes a nuclear protein that is highly conserved in vertebrates. The conserved regions of the protein contain several consensus phosphorylation sites for casein kinase II and cyclin-dependent kinases, two putative nuclear localization signals, and a basic DNA-binding domain. It is phosphorylated in vivo by Cdk1 during mitosis of the cell cycle. [provided by RefSeq, Aug 2010]
Write Your Own Review
You're reviewing:NUCKS1 (NM_022731) Human Untagged Clone
Your Rating
SKU Description Size Price
RC201704 NUCKS1 (Myc-DDK-tagged)-Human nuclear casein kinase and cyclin-dependent kinase substrate 1 (NUCKS1) 10 ug
$300.00
RC201704L1 Lenti ORF clone of Human nuclear casein kinase and cyclin-dependent kinase substrate 1 (NUCKS1), Myc-DDK-tagged 10 ug
$600.00
RC201704L2 Lenti ORF clone of Human nuclear casein kinase and cyclin-dependent kinase substrate 1 (NUCKS1), mGFP tagged 10 ug
$600.00
RC201704L3 Lenti ORF clone of Human nuclear casein kinase and cyclin-dependent kinase substrate 1 (NUCKS1), Myc-DDK-tagged 10 ug
$600.00
RC201704L4 Lenti ORF clone of Human nuclear casein kinase and cyclin-dependent kinase substrate 1 (NUCKS1), mGFP tagged 10 ug
$600.00
RG201704 NUCKS1 (tGFP-tagged) - Human nuclear casein kinase and cyclin-dependent kinase substrate 1 (NUCKS1) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.