CELA1 (NM_001971) Human Untagged Clone

SKU
SC310592
CELA1 (untagged)-Human chymotrypsin-like elastase family, member 1 (CELA1)
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CELA1
Synonyms ELA1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001971, the custom clone sequence may differ by one or more nucleotides


ATGCTGGTCCTTTATGGACACAGCACCCAGGACCTTCCGGAAACCAATGCCCGCGTAGTCGGAGGGACTG
AGGCCGGGAGGAATTCCTGGCCCTCTCAGATTTCCCTCCAGTACCGGTCTGGAGGTTCCCGGTATCACAC
CTGTGGAGGGACCCTTATCAGACAGAACTGGGTGATGACAGCTGCTCACTGCGTGGATTACCAGAAGACT
TTCCGCGTGGTGGCTGGAGACCATAACCTGAGCCAGAATGATGGCACTGAGCAGTACGTGAGTGTGCAGA
AGATCGTGGTGCATCCATACTGGAACAGCGATAACGTGGCTGCCGGCTATGACATCGCCCTGCTGCGCCT
GGCCCAGAGCGTTACCCTCAATAGCTATGTCCAGCTGGGTGTTCTGCCCCAGGAGGGAGCCATCCTGGCT
AACAACAGTCCCTGCTACATCACAGGCTGGGGCAAGACCAAGACCAATGGGCAGCTGGCCCAGACCCTGC
AGCAGGCTTACCTGCCCTCTGTGGACTACGCCATCTGCTCCAGCTCCTCCTACTGGGGCTCCACTGTGAA
GAACACCATGGTGTGTGCTGGTGGAGATGGAGTTCGCTCTGGATGCCAGGGTGACTCTGGGGGCCCCCTC
CATTGCTTGGTGAATGGCAAGTATTCTGTCCATGGAGTGACCAGCTTTGTGTCCAGCCGGGGCTGTAATG
TCTCCAGGAAGCCTACAGTCTTCACCCAGGTCTCTGCTTACATCTCCTGGATAAATAATGTCATCGCCTC
CAACTGA


Restriction Sites Please inquire
ACCN NM_001971
Insert Size 800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001971.4, NP_001962.3
RefSeq Size 952 bp
RefSeq ORF 777 bp
Locus ID 1990
UniProt ID Q9UNI1
Cytogenetics 12q13.13
Protein Families Druggable Genome, Protease, Secreted Protein
Summary Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. Humans have six elastase genes which encode the structurally similar proteins elastase 1, 2, 2A, 2B, 3A, and 3B. Unlike other elastases, pancreatic elastase 1 is not expressed in the pancreas. To date, elastase 1 expression has only been detected in skin keratinocytes. Clinical literature that describes human elastase 1 activity in the pancreas or fecal material is actually referring to chymotrypsin-like elastase family, member 3B. [provided by RefSeq, May 2009]
Write Your Own Review
You're reviewing:CELA1 (NM_001971) Human Untagged Clone
Your Rating
SKU Description Size Price
RC210160 CELA1 (Myc-DDK-tagged)-Human chymotrypsin-like elastase family, member 1 (CELA1) 10 ug
$300.00
RC210160L3 Lenti ORF clone of Human chymotrypsin-like elastase family, member 1 (CELA1), Myc-DDK-tagged 10 ug
$600.00
RC210160L4 Lenti ORF clone of Human chymotrypsin-like elastase family, member 1 (CELA1), mGFP tagged 10 ug
$600.00
RG210160 CELA1 (tGFP-tagged) - Human chymotrypsin-like elastase family, member 1 (CELA1) 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.