HMBS (NM_000190) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | HMBS |
Synonyms | PBG-D; PBGD; PORC; UPS |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene ORF sequence for NM_000190 edited
ATGTCTGGTAACGGCAATGCGGCTGCAACGGCGGAAGAAAACAGCCCAAAGATGAGAGTG ATTCGCGTGGGTACCCGCAAGAGCCAGCTTGCTCGCATACAGACGGACAGTGTGGTGGCA ACATTGAAAGCCTCGTACCCTGGCCTGCAGTTTGAAATCATTGCTATGTCCACCACAGGG GACAAGATTCTTGATACTGCACTCTCTAAGATTGGAGAGAAAAGCCTGTTTACCAAGGAG CTTGAACATGCCCTGGAGAAGAATGAAGTGGACCTGGTTGTTCACTCCTTGAAGGACCTG CCCACTGTGCTTCCTCCTGGCTTCACCATCGGAGCCATCTGCAAGCGGGAAAACCCTCAT GATGCTGTTGTCTTTCACCCAAAATTTGTTGGGAAGACCCTAGAAACCCTGCCAGAGAAG AGTGTGGTGGGAACCAGCTCCCTGCGAAGAGCAGCCCAGCTGCAGAGAAAGTTCCCGCAT CTGGAGTTCAGGAGTATTCGGGGAAACCTCAACACCCGGCTTCGGAAGCTGGACGAGCAG CAGGAGTTCAGTGCCATCATCCTGGCAACAGCTGGCCTGCAGCGCATGGGCTGGCACAAC CGGGTTGGGCAGATCCTGCACCCTGAGGAATGCATGTATGCTGTGGGCCAGGGGGCCTTG GGCGTGGAAGTGCGAGCCAAGGACCAGGACATCTTGGATCTGGTGGGTGTGCTGCACGAT CCCGAGACTCTGCTTCGCTGCATCGCTGAAAGGGCCTTCCTGAGGCACCTGGAAGGAGGC TGCAGTGTGCCAGTAGCCGTGCATACAGCTATGAAGGATGGGCAACTGTACCTGACTGGA GGAGTCTGGAGTCTAGACGGCTCAGATAGCATACAAGAGACCATGCAGGCTACCATCCAT GTCCCTGCCCAGCATGAAGATGGCCCTGAGGATGACCCACAGTTGGTAGGCATCACTGCT CGTAACATTCCACGAGGGCCCCAGTTGGCTGCCCAGAACTTGGGCATCAGCCTGGCCAAC TTGTTGCTGAGCAAAGGAGCCAAAAACATCCTGGATGTTGCACGGCAGCTTAACGATGCC CATTAA |
Restriction Sites | NotI-NotI |
ACCN | NM_000190 |
Insert Size | 1500 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000190.3. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_000190.3, NP_000181.2 |
RefSeq Size | 1526 bp |
RefSeq ORF | 1086 bp |
Locus ID | 3145 |
UniProt ID | P08397 |
Cytogenetics | 11q23.3 |
Domains | Porphobil_deam |
Protein Families | Druggable Genome |
Protein Pathways | Metabolic pathways, Porphyrin and chlorophyll metabolism |
Summary | This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC201362 | HMBS (Myc-DDK-tagged)-Human hydroxymethylbilane synthase (HMBS), transcript variant 1 | 10 ug |
$457.00
|
|
RC201362L1 | Lenti ORF clone of Human hydroxymethylbilane synthase (HMBS), transcript variant 1, Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC201362L2 | Lenti ORF clone of Human hydroxymethylbilane synthase (HMBS), transcript variant 1, mGFP tagged | 10 ug |
$757.00
|
|
RC201362L3 | Lenti ORF clone of Human hydroxymethylbilane synthase (HMBS), transcript variant 1, Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC201362L4 | Lenti ORF clone of Human hydroxymethylbilane synthase (HMBS), transcript variant 1, mGFP tagged | 10 ug |
$757.00
|
|
RG201362 | HMBS (tGFP-tagged) - Human hydroxymethylbilane synthase (HMBS), transcript variant 1 | 10 ug |
$489.00
MSRP
$657.00
MSRP
$657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.