5HT4 Receptor (HTR4) (NM_000870) Human Untagged Clone

SKU
SC310455
HTR4 (untagged)-Human 5-hydroxytryptamine (serotonin) receptor 4 (HTR4), transcript variant b
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol 5HT4 Receptor
Synonyms 5-HT4; 5-HT4R
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000870 edited
TAATGGACAAACTTGATGCTAATGTGAGTTCTGAGGAGGGTTTCGGGTCAGTGGAGAAGG
TGGTGCTGCTCACGTTTCTCTCGACGGTTATCCTGATGGCCATCTTGGGGAACCTGCTGG
TGATGGTGGCTGTGTGCTGGGACAGGCAGCTCAGGAAAATAAAAACAAATTATTTCATTG
TATCTCTTGCTTTTGCGGATCTGCTGGTTTCGGTGCTGGTGATGCCCTTTGGTGCCATTG
AGCTGGTTCAAGACATCTGGATTTATGGGGAGGTGTTTTGTCTTGTTCGGACATCTCTGG
ACGTCCTGCTCACAACGGCATCGATTTTTCACCTGTGCTGCATTTCTCTGGATAGGTATT
ACGCCATCTGCTGCCAGCCTTTGGTCTATAGGAACAAGATGACCCCTCTGCGCATCGCAT
TAATGCTGGGAGGCTGCTGGGTCATCCCCACGTTTATTTCTTTTCTCCCTATAATGCAAG
GCTGGAATAACATTGGCATAATTGATTTGATAGAAAAGAGGAAGTTCAACCAGAACTCTA
ACTCTACGTACTGTGTCTTCATGGTCAACAAGCCCTACGCCATCACCTGCTCTGTGGTGG
CCTTCTACATCCCATTTCTCCTCATGGTGCTGGCCTATTACCGCATCTATGTCACAGCTA
AGGAGCATGCCCATCAGATCCAGATGTTACAACGGGCAGGAGCCTCCTCCGAGAGCAGGC
CTCAGTCGGCAGACCAGCATAGCACTCATCGCATGAGGACAGAGACCAAAGCAGCCAAGA
CCCTGTGCATCATCATGGGTTGCTTCTGCCTCTGCTGGGCACCATTCTTTGTCACCAATA
TTGTGGATCCTTTCATAGACTACACTGTCCCTGGGCAGGTGTGGACTGCTTTCCTCTGGC
TCGGCTATATCAATTCCGGGTTGAACCCTTTTCTCTACGCCTTCTTGAATAAGTCTTTTA
GACGTGCCTTCCTCATCATCCTCTGCTGTGATGATGAGCGCTACCGAAGACCTTCCATTC
TGGGCCAGACTGTCCCTTGTTCAACCACAACCATTAATGGATCCACACATGTACTAAGGG
ATGCAGTGGAGTGTGGTGGCCAGTGGGAGAGTCAGTGTCACCCGCCAGCAACTTCTCCTT
TGGTGGCTGCTCAGCCCAGTGACACTTAGGCCCCTGGGACAATGACCCAGAAGACAGCCA
T
Restriction Sites Please inquire
ACCN NM_000870
Insert Size 1200 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000870.1.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000870.2, NP_000861.1
RefSeq Size 3005 bp
RefSeq ORF 1167 bp
Locus ID 3360
UniProt ID Q13639
Cytogenetics 5q32
Domains 7tm_1
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Calcium signaling pathway, Neuroactive ligand-receptor interaction
Summary This gene is a member of the family of serotonin receptors, which are G protein coupled receptors that stimulate cAMP production in response to serotonin (5-hydroxytryptamine). The gene product is a glycosylated transmembrane protein that functions in both the peripheral and central nervous system to modulate the release of various neurotransmitters. Multiple transcript variants encoding proteins with distinct C-terminal sequences have been described. [provided by RefSeq, May 2010]
Transcript Variant: This variant (b) encodes the longest isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:5HT4 Receptor (HTR4) (NM_000870) Human Untagged Clone
Your Rating
SKU Description Size Price
RC210367 HTR4 (Myc-DDK-tagged)-Human 5-hydroxytryptamine (serotonin) receptor 4 (HTR4), transcript variant b 10 ug
$457.00
RC210367L3 Lenti ORF clone of Human 5-hydroxytryptamine (serotonin) receptor 4 (HTR4), transcript variant b, Myc-DDK-tagged 10 ug
$757.00
RC210367L4 Lenti ORF clone of Human 5-hydroxytryptamine (serotonin) receptor 4 (HTR4), transcript variant b, mGFP tagged 10 ug
$757.00
RG210367 HTR4 (tGFP-tagged) - Human 5-hydroxytryptamine (serotonin) receptor 4 (HTR4), transcript variant b 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.