NAP1L1 (NM_004537) Human Untagged Clone

SKU
SC310447
NAP1L1 (untagged)-Human nucleosome assembly protein 1-like 1 (NAP1L1), transcript variant 2
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NAP1L1
Synonyms NAP1; NAP1L; NRP
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_004537 edited
ATGGCAGACATTGACAACAAAGAACAGTCTGAACTTGATCAAGATTTGGATGATGTTGAA
GAAGTAGAAGAAGAGGAAACTGGTGAAGAAACAAAACTCAAAGCACGTCAGCTAACTGTT
CAGATGATGCAAAATCCTCAGATTCTTGCAGCCCTTCAAGAAAGACTTGATGGTCTGGTA
GAAACACCAACAGGATACATTGAAAGCCTGCCTAGGGTAGTTAAAAGACGAGTGAATGCT
CTCAAAAACCTGCAAGTTAAATGTGCACAGATAGAAGCCAAATTCTATGAGGAAGTTCAT
GATCTTGAAAGGAAGTATGCTGTTCTCTATCAGCCTCTATTTGATAAGCGATTTGAAATT
ATTAATGCAATTTATGAACCTACGGAAGAAGAATGTGAATGGAAACCAGATGAAGAAGAT
GAGATTTCGGAGGAATTGAAAGAAAAGGCCAAGATTGAAGATGAGAAAAAGGATGAAGAA
AAAGAAGACCCCAAAGGAATTCCTGAATTTTGGTTAACTGTTTTTAAGAATGTTGACTTG
CTCAGTGATATGGTTCAGGAACACGATGAACCTATTCTGAAGCACTTGAAAGATATTAAA
GTGAAGTTCTCAGATGCTGGCCAGCCTATGAGTTTTGTCTTAGAATTTCACTTTGAACCC
AATGAATATTTTACAAATGAAGTGCTGACAAAGACATACAGGATGAGGTCAGAACCAGAT
GATTCTGATCCCTTTTCTTTTGATGGACCAGAAATTATGGGTTGTACAGGGTGCCAGATA
GATTGGAAAAAAGGAAAGAATGTCACTTTGAAAACTATTAAGAAGAAGCAGAAACACAAG
GGACGTGGGACAGTTCGTACTGTGACTAAAACAGTTTCCAATGACTCTTTCTTTAACTTT
TTTGCCCCTCCTGAAGTTCCTGAGAGTGGAGATCTGGATGATGATGCTGAAGCTATCCTT
GCTGCAGACTTCGAAATTGGTCACTTTTTACGTGAGCGTATAATCCCAAGATCAGTGTTA
TATTTTACTGGAGAAGCTATTGAAGATGATGATGATGATTATGATGAAGAAGGTGAAGAA
GCGGATGAGGAAGGGGAAGAAGAAGGAGATGAGGAAAATGATCCAGACTATGACCCAAAG
AAGGATCAAAACCCAGCAGAGTGCAAGCAGCAGTGA
Restriction Sites Please inquire
ACCN NM_004537
Insert Size 1200 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_004537.3, NP_004528.1
RefSeq Size 2908 bp
RefSeq ORF 1176 bp
Locus ID 4673
UniProt ID P55209
Cytogenetics 12q21.2
Domains NAP
Summary This gene encodes a member of the nucleosome assembly protein (NAP) family. This protein participates in DNA replication and may play a role in modulating chromatin formation and contribute to the regulation of cell proliferation. Alternative splicing results in multiple transcript variants encoding different isoforms; however, not all have been fully described. [provided by RefSeq, Apr 2015]
Transcript Variant: This variant (2) represents the longest transcript and encodes the longer isoform (1). Variants 1, 2 and 4 encode the same isoform (1).
Write Your Own Review
You're reviewing:NAP1L1 (NM_004537) Human Untagged Clone
Your Rating
SKU Description Size Price
RC220821 NAP1L1 (Myc-DDK-tagged)-Human nucleosome assembly protein 1-like 1 (NAP1L1), transcript variant 2 10 ug
$457.00
RC220821L1 Lenti ORF clone of Human nucleosome assembly protein 1-like 1 (NAP1L1), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC220821L2 Lenti ORF clone of Human nucleosome assembly protein 1-like 1 (NAP1L1), transcript variant 2, mGFP tagged 10 ug
$757.00
RC220821L3 Lenti ORF clone of Human nucleosome assembly protein 1-like 1 (NAP1L1), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC220821L4 Lenti ORF clone of Human nucleosome assembly protein 1-like 1 (NAP1L1), transcript variant 2, mGFP tagged 10 ug
$757.00
RG220821 NAP1L1 (tGFP-tagged) - Human nucleosome assembly protein 1-like 1 (NAP1L1), transcript variant 2 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.