beta TRCP2 (FBXW11) (NM_012300) Human Untagged Clone

SKU
SC310284
FBXW11 (untagged)-Human F-box and WD repeat domain containing 11 (FBXW11), transcript variant 3
$758.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol beta TRCP2
Synonyms BTRC2; BTRCP2; FBW1B; Fbw11; FBXW1B; Hos; NEDJED
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_012300 edited
ATGGAGCCCGACTCGGTGATTGAGGACAAGACCATCGAGCTCATGTGTTCTGTGCCAAGG
TCTTTGTGGCTAGGCTGCGCCAACCTGGTAGAGAGCATGTGCGCACTGAGTTGCCTGCAG
AGCATGCCCAGTGTCAGATGTCTCCAGATAAGTAATGGAACATCATCTGTGATCGTCTCC
AGAAAGAGGCCATCAGAAGGAAACTATCAAAAAGAAAAAGACTTGTGTATTAAATATTTT
GACCAGTGGTCTGAATCAGATCAAGTGGAATTTGTGGAACATCTTATTTCACGAATGTGT
CATTATCAGCATGGACATATTAACTCTTACCTGAAGCCCATGTTGCAGCGGGACTTTATT
ACCGCTTTACCAGAGCAAGGCTTAGATCACATAGCAGAAAACATTCTTTCGTACCTGGAT
GCCAGGTCTCTGTGTGCAGCAGAGCTGGTATGTAAAGAATGGCAGCGAGTGATCTCAGAA
GGAATGCTTTGGAAGAAGCTGATTGAACGAATGGTACGCACTGATCCCCTATGGAAAGGA
CTTTCAGAAAGAAGAGGGTGGGATCAGTACCTGTTTAAAAACAGACCCACAGATGGCCCT
CCAAATTCATTTTATAGGTCATTATACCCAAAGATTATCCAGGATATAGAGACTATAGAA
TCTAACTGGCGGTGTGGACGACACAACTTGCAGAGGATTCAGTGCCGCTCTGAAAATAGT
AAAGGTGTCTACTGTTTACAGTACGATGATGAAAAAATTATCAGTGGCCTACGAGATAAT
TCTATTAAGATATGGGATAAAACCAGCCTGGAATGTTTGAAAGTGTTAACAGGACACACA
GGCTCTGTCCTCTGTCTGCAGTATGATGAGCGTGTCATTGTAACTGGCTCTTCAGATTCT
ACGGTGAGAGTGTGGGATGTGAACACGGGTGAAGTTCTTAACACATTGATCCACCACAAT
GAGGCTGTATTGCACTTACGCTTCAGCAATGGACTGATGGTGACCTGTTCCAAGGACCGC
TCCATTGCTGTGTGGGACATGGCTTCTGCGACCGACATCACTTTACGCCGTGTCCTGGTT
GGCCACCGGGCTGCCGTCAATGTAGTAGACTTTGACGACAAGTACATCGTGTCTGCCTCT
GGTGACAGGACCATCAAAGTCTGGAGCACGAGCACCTGTGAATTTGTTCGTACTCTCAAT
GGGCACAAGCGGGGCATTGCCTGTCTCCAGTACAGGGATCGCCTGGTTGTTAGTGGATCA
TCAGATAATACCATTAGGCTCTGGGATATTGAATGTGGTGCCTGTTTAAGAGTCCTAGAG
GGACATGAAGAATTGGTCCGATGCATCCGGTTTGATAACAAGAGGATTGTCAGTGGGGCC
TATGATGGGAAAATTAAAGTTTGGGACTTGCAAGCTGCTCTTGACCCTCGAGCCCCAGCA
AGCACATTGTGTTTGCGCACATTGGTGGAACATTCTGGACGTGTGTTTCGGCTCCAGTTT
GATGAGTTTCAGATCATCAGCAGCTCCCATGATGACACTATTTTGATTTGGGATTTCTTA
AATGTGCCTCCCAGTGCCCAGAATGAGACCCGTTCTCCCTCCAGAACATACACTTACATC
TCTAGATAA
Restriction Sites NotI-NotI
ACCN NM_012300
Insert Size 4400 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_012300.2.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_012300.2, NP_036432.2
RefSeq Size 4575 bp
RefSeq ORF 1629 bp
Locus ID 23291
UniProt ID Q9UKB1
Cytogenetics 5q35.1
Domains F-box, WD40
Protein Families Druggable Genome
Protein Pathways Hedgehog signaling pathway, Oocyte meiosis, Ubiquitin mediated proteolysis, Wnt signaling pathway
Summary This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbws class and, in addition to an F-box, contains multiple WD40 repeats. This gene contains at least 14 exons, and its alternative splicing generates 3 transcript variants diverging at the presence/absence of two alternate exons. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) encodes the longest isoform (C).
Write Your Own Review
You're reviewing:beta TRCP2 (FBXW11) (NM_012300) Human Untagged Clone
Your Rating
SKU Description Size Price
RC218905 FBXW11 (Myc-DDK-tagged)-Human F-box and WD repeat domain containing 11 (FBXW11), transcript variant 3 10 ug
$757.00
RC218905L1 Lenti ORF clone of Human F-box and WD repeat domain containing 11 (FBXW11), transcript variant 3, Myc-DDK-tagged 10 ug
$1,057.00
RC218905L2 Lenti ORF clone of Human F-box and WD repeat domain containing 11 (FBXW11), transcript variant 3, mGFP tagged 10 ug
$1,057.00
RC218905L3 Lenti ORF clone of Human F-box and WD repeat domain containing 11 (FBXW11), transcript variant 3, Myc-DDK-tagged 10 ug
$1,057.00
RC218905L4 Lenti ORF clone of Human F-box and WD repeat domain containing 11 (FBXW11), transcript variant 3, mGFP tagged 10 ug
$1,057.00
RG218905 FBXW11 (tGFP-tagged) - Human F-box and WD repeat domain containing 11 (FBXW11), transcript variant 3 10 ug
$957.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.