Tau(MAPT) (NM_005910) Human Untagged Clone

CAT#: SC309606

MAPT (untagged)-Human microtubule-associated protein tau (MAPT), transcript variant 2

USD 701


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Tau(MAPT) (NM_005910) Human Untagged Clone
Symbol MAPT
Synonyms DDPAC; FTDP-17; MAPTL; MSTD; MTBT1; MTBT2; PPND; PPP1R103; TAU
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_005910 edited
GGACGGCCGAGCGGCAGGGCGCTCGCGCGCGCCCACTAGTGGCCGGAGGAGAAGGCTCCC
GCGGAGGCCGCGCTGCCCGCCCCCTCCCCTGGGGAGGCTCGCGTTCCCGCTGCTCGCGCC
TGCGCCGCCCGCCGGCCTCAGGAACGCGCCCTCTTCGCCGGCGCGCGCCCTCGCAGTCAC
CGCCACCCACCAGCTCCGGCACCAACAGCAGCGCCGCTGCCACCGCCCACCTTCTGCCGC
CGCCACCACAGCCACCTTCTCCTCCTCCGCTGTCCTCTCCCGTCCTCGCCTCTGTCGACT
ATCAGGTGAACTTTGAACCAGGATGGCTGAGCCCCGCCAGGAGTTCGAAGTGATGGAAGA
TCACGCTGGGACGTACGGGTTGGGGGACAGGAAAGATCAGGGGGGCTACACCATGCACCA
AGACCAAGAGGGTGACACGGACGCTGGCCTGAAAGAATCTCCCCTGCAGACCCCCACTGA
GGACGGATCTGAGGAACCGGGCTCTGAAACCTCTGATGCTAAGAGCACTCCAACAGCGGA
AGATGTGACAGCACCCTTAGTGGATGAGGGAGCTCCCGGCAAGCAGGCTGCCGCGCAGCC
CCACACGGAGATCCCAGAAGGAACCACAGCTGAAGAAGCAGGCATTGGAGACACCCCCAG
CCTGGAAGACGAAGCTGCTGGTCACGTGACCCAAGCTCGCATGGTCAGTAAAAGCAAAGA
CGGGACTGGAAGCGATGACAAAAAAGCCAAGGGGGCTGATGGTAAAACGAAGATCGCCAC
ACCGCGGGGAGCAGCCCCTCCAGGCCAGAAGGGCCAGGCCAACGCCACCAGGATTCCAGC
AAAAACCCCGCCCGCTCCAAAGACACCACCCAGCTCTGGTGAACCTCCAAAATCAGGGGA
TCGCAGCGGCTACAGCAGCCCCGGCTCCCCAGGCACTCCCGGCAGCCGCTCCCGCACCCC
GTCCCTTCCAACCCCACCCACCCGGGAGCCCAAGAAGGTGGCAGTGGTCCGTACTCCACC
CAAGTCGCCGTCTTCCGCCAAGAGCCGCCTGCAGACAGCCCCCGTGCCCATGCCAGACCT
GAAGAATGTCAAGTCCAAGATCGGCTCCACTGAGAACCTGAAGCACCAGCCGGGAGGCGG
GAAGGTGCAGATAATTAATAAGAAGCTGGATCTTAGCAACGTCCAGTCCAAGTGTGGCTC
AAAGGATAATATCAAACACGTCCCGGGAGGCGGCAGTGTGCAAATAGTCTACAAACCAGT
TGACCTGAGCAAGGTGACCTCCAAGTGTGGCTCATTAGGCAACATCCATCATAAACCAGG
AGGTGGCCAGGTGGAAGTAAAATCTGAGAAGCTTGACTTCAAGGACAGAGTCCAGTCGAA
GATTGGGTCCCTGGACAATATCACCCACGTCCCTGGCGGAGGAAATAAAAAGATTGAAAC
CCACAAGCTGACCTTCCGCGAGAACGCCAAAGCCAAGACAGACCACGGGGCGGAGATCGT
GTACAAGTCGCCAGTGGTGTCTGGGGACACGTCTCCACGGCATCTCAGCAATGTCTCCTC
CACCGGCAGCATCGACATGGTAGACTCGCCCCAGCTCGCCACGCTAGCTGACGAGGTGTC
TGCCTCCCTGGCCAAGCAGGGTTTGTGATCAGGCCCCTGGGGCGGTCAATAATTGTGGAG
AGGAGAGAATGAGAGAGTGTGGAAAAAAAAAGAATAATGACCCGGCCCCCGCCCTCTGCC
CCCAGCTGCTCCTCGCAGTTCGGTTAATTGGTTAATCACTTAACCTGCTTTTGTCACTCG
GCTTTGGCTCGGGACTTCAAAATCAGTGATGGGAGTAAGAGCAAATTTCATCTTTCCAAA
TTGATGGGTGGGCTAGTAATAAAATATTTAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_005910 unedited
ACGTCANCATTTGTATACGACTCACTATAGGCGGCCGCGAATTCGGCACGAGGGGACGGC
CGAGCGGCAGGGCGCTCGCGCGCGCCCACTAGTGGCCGGAGGAGAAGGCTCCCGCGGAGG
CCGCGCTGCCCGCCCCCTCCCCTGGGGAGGCTCGCGTTCCCGCTGCTCGCGCCTGCGCCG
CCCGCCGGCCTCAGGAACGCGCCCTCTTCGCCGGCGCGCGCCCTCGCAGTCACCGCCACC
CACCAGCTCCGGCACCAACAGCAGCGCCGCTGCCACCGCCCACCTTCTGCCGCCGCCACC
ACAGCCACCTTCTCCTCCTCCGCTGTCCTCTCCCGTCCTCGCCTCTGTCGACTATCAGGT
GAACTTTGAACCAGGATGGCTGAGCCCCGCCAGGAGTTCGAAGTGATGGAAGATCACGCT
GGGACGTACGGGTTGGGGGACAGGAAAGATCAGGGGGGCTACACCATGCACCAAGACCAA
GAGGGTGACACGGACGCTGGCCTGAAAGAATCTCCCCTGCAGACCCCCACTGAGGACGGA
TCTGAGGAACCGGGCTCTGANACCTCTGATGCTAAGAGCACTCCAACAGCGGAAGATGTG
ACAGCACCCTTAGTGGATGAGGGAGCTCCCGGGCAGCANGCTGCCGCGCAGCCCCACACG
GAGATCCCAGAAGGAACCACAGCTGAAGAAGCAGGCATTGGAGACACCCCCAGCCTGGAA
GACGAAGCTGCTGGTCACGTGACCCCAGCTCGCATGGTCAGTAAAAGCAAAGACGGGACT
GAAAGCGATGACAAAAAAGCCCAGGGGGCTGATGGGAAAACGAAGATCGGCACACCGCGG
GGAGCAGCCCCTTCCAGGCACGAGGGCCAGNCCAAACCCACCAGGATTCCAGCAAAAACC
CCCCCCGCTCCAAAAC
3' Read Nucleotide Sequence
>Forward primer walk for NM_005910 unedited
GGGTCTTCACGCAACCCGGAGNGACAGCCCCTCCAGNCCATAAGGCCAGGCCAACGCCAC
CAGGAATTCCATCAAAAACCCCGCCCGCTCCAAAAACACCACCCAGCTCTGGTGAACCTC
CAAAATCAGGGGATCGCAGCGGCTACAGCAGCCCCGGCTCCCCAGGCACTCCCGGCAGCC
GCTCCCGCACCCCGTCCCTTCCAACCCCACCCACCCGGGAGCCCAAGAAGGTGGCAGTGG
TCCGTACTCCACCCAAGTCGCCGTCTTCCGCCAAGAGCCGCCTGCAGACAGCCCCCGTGC
CCATGCCAGACCTGAAGAATGTCAAGTCCAAGATCGGCTCCACTGAGAACCTGAAGCACC
AGCCGGGAGGCGGGAAGGTGCAGATAATTAATAAGAAGCTGGATCTTAGCAACGTCCAGT
CCAAGTGTGGCTCAAAGGATAATATCAAACACGTCCCGGGAGGCGGCAGTGTGCAAATAG
TCTACAAACCAGTTGACCTGAGCAAGGTGACCTCCAAGTGTGGCTCATTAGGCAACATCC
ATCATANACCAGGAGGTGGCCAGGTGGAAGTAAAATCTGAGAAGCTTGACTTCAAGGACA
GAGTCCAGTCGAAGATTGGGTCCCTGGACAATATCACCCACGTCCCTGGCGGAGGAAATA
AAAAGATTGAGACCCACAAGCTGACCTTCCGCGAGAACGCCAAAGCCAAGACAGACCCAC
GGGCGGAGATCGTGTACAAGTCGCCAGTGGTGTCTGGGGACACGTCTTCACGGCATCTCA
GCATGTCTCCTCCACCGGCAGCATCGACATGGTAGACTCGCCCCAGCTCGCCACGCTAGC
TGACGAGGTGTCTGCCTCCCTGGCAAACAAGTTTTGTGATCAGGCCCCTGGGCCGGGCAA
TATTGGTGG
Tag Tag Free
ACCN NM_005910
ORF Size 1326 bp
Insert Size 1900
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_005910.3, NP_005901
RefSeq Size 5731
RefSeq ORF 1326
Locus ID 4137
Cytogenetics 17q21.31
Domains tubulin-binding
Protein Families Druggable Genome
Protein Pathways MAPK signaling pathway, Alzheimer's disease
Gene Summary This gene encodes the microtubule-associated protein tau (MAPT) whose transcript undergoes complex, regulated alternative splicing, giving rise to several mRNA species. MAPT transcripts are differentially expressed in the nervous system, depending on stage of neuronal maturation and neuron type. MAPT gene mutations have been associated with several neurodegenerative disorders such as Alzheimer's disease, Pick's disease, frontotemporal dementia, cortico-basal degeneration and progressive supranuclear palsy. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks three internal coding exons, as compared to variant 6. The reading frame is not affected, and the resulting isoform (2) has identical N- and C-termini but lacks three segments, as compared to isoform 6.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.