NOTCH1 (NM_017617) Human Untagged Clone

CAT#: SC308883

NOTCH1 (untagged)-Human notch 1 (NOTCH1)

USD 4,883.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name NOTCH1 (NM_017617) Human Untagged Clone
Symbol NOTCH1
Synonyms AOS5; AOVD1; hN1; TAN1
Vector pCMV6-XL6
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_017617 edited
ATGCCGCCGCTCCTGGCGCCCCTGCTCTGCCTGGCGCTGCTGCCCGCGCTCGCCGCACGA
GGCCCGCGATGCTCCCAGCCCGGTGAGACCTGCCTGAATGGCGGGAAGTGTGAAGCGGCC
AATGGCACGGAGGCCTGCGTCTGTGGCGGGGCCTTCGTGGGCCCGCGATGCCAGGACCCC
AACCCGTGCCTCAGCACCCCCTGCAAGAACGCCGGGACATGCCACGTGGTGGACCGCAGA
GGCGTGGCAGACTATGCCTGCAGCTGTGCCCTGGGCTTCTCTGGGCCCCTCTGCCTGACA
CCCCTGGACAATGCCTGCCTCACCAACCCCTGCCGCAACGGGGGCACCTGCGACCTGCTC
ACGCTGACGGAGTACAAGTGCCGCTGCCCGCCCGGCTGGTCAGGGAAATCGTGCCAGCAG
GCTGACCCGTGCGCCTCCAACCCCTGCGCCAACGGTGGCCAGTGCCTGCCCTTCGAGGCC
TCCTACATCTGCCACTGCCCACCCAGCTTCCATGGCCCCACCTGCCGGCAGGATGTCAAC
GAGTGTGGCCAGAAGCCCGGGCTTTGCCGCCACGGAGGCACCTGCCACAACGAGGTCGGC
TCCTACCGCTGCGTCTGCCGCGCCACCCACACTGGCCCCAACTGCGAGCGGCCCTACGTG
CCCTGCAGCCCCTCGCCCTGCCAGAACGGGGGCACCTGCCGCCCCACGGGCGACGTCACC
CACGAGTGTGCCTGCCTGCCAGGCTTCACCGGCCAGAACTGTGAGGAAAATATCGACGAT
TGTCCAGGAAACAACTGCAAGAACGGGGGTGCCTGTGTGGACGGCGTGAACACCTACAAC
TGCCGCTGCCCGCCAGAGTGGACAGGTCAGTACTGTACCGAGGATGTGGACGAGTGCCAG
CTGATGCCAAATGCCTGCCAGAACGGCGGGACCTGCCACAACACCCACGGTGGCTACAAC
TGCGTGTGTGTCAACGGCTGGACTGGTGAGGACTGCAGCGAGAACATTGATGACTGTGCC
AGCGCCGCCTGCTTCCACGGCGCCACCTGCCATGACCGTGTGGCCTCCTTCTACTGCGAG
TGTCCCCATGGCCGCACAGGTCTGCTGTGCCACCTCAACGACGCATGCATCAGCAACCCC
TGTAACGAGGGCTCCAACTGCGACACCAACCCTGTCAATGGCAAGGCCATCTGCACCTGC
CCCTCGGGGTACACGGGCCCGGCCTGCAGCCAGGACGTGGATGAGTGCTCGCTGGGTGCC
AACCCCTGCGAGCATGCGGGCAAGTGCATCAACACGCTGGGCTCCTTCGAGTGCCAGTGT
CTGCAGGGCTACACGGGCCCCCGATGCGAGATCGACGTCAACGAGTGCGTCTCGAACCCG
TGCCAGAACGACGCCACCTGCCTGGACCAGATTGGGGAGTTCCAGTGCATCTGCATGCCC
GGCTACGAGGGTGTGCACTGCGAGGTCAACACAGACGAGTGTGCCAGCAGCCCCTGCCTG
CACAATGGCCGCTGCCTGGACAAGATCAATGAGTTCCAGTGCGAGTGCCCCACGGGCTTC
ACTGGGCATCTGTGCCAGTACGATGTGGACGAGTGTGCCAGCACCCCCTGCAAGAATGGT
GCCAAGTGCCTGGACGGACCCAACACTTACACCTGTGTGTGCACGGAAGGGTACACGGGG
ACGCACTGCGAGGTGGACATCGATGAGTGCGACCCCGACCCCTGCCACTACGGCTCCTGC
AAGGACGGCGTCGCCACCTTCACCTGCCTCTGCCGCCCAGGCTACACGGGCCACCACTGC
GAGACCAACATCAACGAGTGCTCCAGCCAGCCCTGCCGCCACGGGGGCACCTGCCAGGAC
CGCGACAACGCCTACCTCTGCTTCTGCCTGAAGGGGACCACAGGACCCAACTGCGAGATC
AACCTGGATGACTGTGCCAGCAGCCCCTGCGACTCGGGCACCTGTCTGGACAAGATCGAT
GGCTACGAGTGTGCCTGTGAGCCGGGCTACACAGGGAGCATGTGTAACATCAACATCGAT
GAGTGTGCGGGCAACCCCTGCCACAACGGGGGCACCTGCGAGGACGGCATCAATGGCTTC
ACCTGCCGCTGCCCCGAGGGCTACCACGACCCCACCTGCCTGTCTGAGGTCAATGAGTGC
AACAGCAACCCCTGCGTCCACGGGGCCTGCCGGGACAGCCTCAACGGGTACAAGTGCGAC
TGTGACCCTGGGTGGAGTGGGACCAACTGTGACATCAACAACAATGAGTGTGAATCCAAC
CCTTGTGTCAACGGCGGCACCTGCAAAGACATGACCAGTGGCTACGTGTGCACCTGCCGG
GAGGGCTTCAGCGGTCCCAACTGCCAGACCAACATCAACGAGTGTGCGTCCAACCCATGT
CTGAACCAGGGCACGTGTATTGACGACGTTGCCGGGTACAAGTGCAACTGCCTGCTGCCC
TACACAGGTGCCACGTGTGAGGTGGTGCTGGCCCCGTGTGCCCCCAGCCCCTGCAGAAAC
GGCGGGGAGTGCAGGCAATCCGAGGACTATGAGAGCTTCTCCTGTGTCTGCCCCACGGGC
TGGCAAGCAGGGCAGACCTGTGAGGTCGACATCAACGAGTGCGTTCTGAGCCCGTGCCGG
CACGGCGCATCCTGCCAGAACACCCACGGCGGCTACCGCTGCCACTGCCAGGCCGGCTAC
AGTGGGCGCAACTGCGAGACCGACATCGACGACTGCCGGCCCAACCCGTGTCACAACGGG
GGCTCCTGCACAGACGGCATCAACACGGCCTTCTGCGACTGCCTGCCCGGCTTCCGGGGC
ACTTTCTGTGAGGAGGACATCAACGAGTGTGCCAGTGACCCCTGCCGCAACGGGGCCAAC
TGCACGGACTGCGTGGACAGCTACACGTGCACCTGCCCCGCAGGCTTCAGCGGGATCCAC
TGTGAGAACAACACGCCTGACTGCACAGAGAGCTCCTGCTTCAACGGTGGCACCTGCGTG
GACGGCATCAACTCGTTCACCTGCCTGTGTCCACCCGGCTTCACGGGCAGCTACTGCCAG
CACGATGTCAATGAGTGCGACTCACAGCCCTGCCTGCATGGCGGCACCTGTCAGGACGGC
TGCGGCTCCTACAGGTGCACCTGCCCCCAGGGCTACACTGGCCCCAACTGCCAGAACCTT
GTGCACTGGTGTGACTCCTCGCCCTGCAAGAACGGCGGCAAATGCTGGCAGACCCACACC
CAGTACCGCTGCGAGTGCCCCAGCGGCTGGACCGGCCTTTACTGCGACGTGCCCAGCGTG
TCCTGTGAGGTGGCTGCGCAGCGACAAGGTGTTGACGTTGCCCGCCTGTGCCAGCATGGA
GGGCTCTGTGTGGACGCGGGCAACACGCACCACTGCCGCTGCCAGGCGGGCTACACAGGC
AGCTACTGTGAGGACCTGGTGGACGAGTGCTCACCCAGCCCCTGCCAGAACGGGGCCACC
TGCACGGACTACCTGGGCGGCTACTCCTGCAAGTGCGTGGCCGGCTACCACGGGGTGAAC
TGCTCTGAGGAGATCGACGAGTGCCTCTCCCACCCCTGCCAGAACGGGGGCACCTGCCTC
GACCTCCCCAACACCTACAAGTGCTCCTGCCCACGGGGCACTCAGGGTGTGCACTGTGAG
ATCAACGTGGACGACTGCAATCCCCCCGTTGACCCCGTGTCCCGGAGCCCCAAGTGCTTT
AACAACGGCACCTGCGTGGACCAGGTGGGCGGCTACAGCTGCACCTGCCCGCCGGGCTTC
GTGGGTGAGCGCTGTGAGGGGGATGTCAACGAGTGCCTGTCCAATCCCTGCGACGCCCGT
GGCACCCAGAACTGCGTGCAGCGCGTCAATGACTTCCACTGCGAGTGCCGTGCTGGTCAC
ACCGGGCGCCGCTGCGAGTCCGTCATCAATGGCTGCAAAGGCAAGCCCTGCAAGAATGGG
GGCACCTGCGCCGTGGCCTCCAACACCGCCCGCGGGTTCATCTGCAAGTGCCCTGCGGGC
TTCGAGGGCGCCACGTGTGAGAATGACGCTCGTACCTGCGGCAGCCTGCGCTGCCTCAAC
GGCGGCACATGCATCTCCGGCCCGCGCAGCCCCACCTGCCTGTGCCTGGGCCCCTTCACG
GGCCCCGAATGCCAGTTCCCGGCCAGCAGCCCCTGCCTGGGCGGCAACCCCTGCTACAAC
CAGGGGACCTGTGAGCCCACATCCGAGAGCCCCTTCTACCGTTGCCTGTGCCCCGCCAAA
TTCAACGGGCTCTTGTGCCACATCCTGGACTACAGCTTCGGGGGTGGGGCCGGGCGCGAC
ATCCCCCCGCCGCTGATCGAGGAGGCGTGCGAGCTGCCCGAGTGCCAGGAGGACGCGGGC
AACAAGGTCTGCAGCCTGCAGTGCAACAACCACGCGTGCGGCTGGGACGGCGGTGACTGC
TCCCTCAACTTCAATGACCCCTGGAAGAACTGCACGCAGTCTCTGCAGTGCTGGAAGTAC
TTCAGTGACGGCCACTGTGACAGCCAGTGCAACTCAGCCGGCTGCCTCTTCGACGGCTTT
GACTGCCAGCGTGCGGAAGGCCAGTGCAACCCCCTGTACGACCAGTACTGCAAGGACCAC
TTCAGCGACGGGCACTGCGACCAGGGCTGCAACAGCGCGGAGTGCGAGTGGGACGGGCTG
GACTGTGCGGAGCATGTACCCGAGAGGCTGGCGGCCGGCACGCTGGTGGTGGTGGTGCTG
ATGCCGCCGGAGCAGCTGCGCAACAGCTCCTTCCACTTCCTGCGGGAGCTCAGCCGCGTG
CTGCACACCAACGTGGTCTTCAAGCGTGACGCACACGGCCAGCAGATGATCTTCCCCTAC
TACGGCCGCGAGGAGGAGCTGCGCAAGCACCCCATCAAGCGTGCCGCCGAGGGCTGGGCC
GCACCTGACGCCCTGCTGGGCCAGGTGAAGGCCTCGCTGCTCCCTGGTGGCAGCGAGGGT
GGGCGGCGGCGGAGGGAGCTGGACCCCATGGACGTCCGCGGCTCCATCGTCTACCTGGAG
ATTGACAACCGGCAGTGTGTGCAGGCCTCCTCGCAGTGCTTCCAGAGTGCCACCGACGTG
GCCGCATTCCTGGGAGCGCTCGCCTCGCTGGGCAGCCTCAACATCCCCTACAAGATCGAG
GCCGTGCAGAGTGAGACCGTGGAGCCGCCCCCGCCGGCGCAGCTGCACTTCATGTACGTG
GCGGCGGCCGCCTTTGTGCTTCTGTTCTTCGTGGGCTGCGGGGTGCTGCTGTCCCGCAAG
CGCCGGCGGCAGCATGGCCAGCTCTGGTTCCCTGAGGGCTTCAAAGTGTCTGAGGCCAGC
AAGAAGAAGCGGCGGGAGCCCCTCGGCGAGGACTCCGTGGGCCTCAAGCCCCTGAAGAAC
GCTTCAGACGGTGCCCTCATGGACGACAACCAGAATGAGTGGGGGGACGAGGACCTGGAG
ACCAAGAAGTTCCGGTTCGAGGAGCCCGTGGTTCTGCCTGACCTGGACGACCAGACAGAC
CACCGGCAGTGGACTCAGCAGCACCTGGATGCCGCTGACCTGCGCATGTCTGCCATGGCC
CCCACACCGCCCCAGGGTGAGGTTGACGCCGACTGCATGGACGTCAATGTCCGCGGGCCT
GATGGCTTCACCCCGCTCATGATCGCCTCCTGCAGCGGGGGCGGCCTGGAGACGGGCAAC
AGCGAGGAAGAGGAGGACGCGCCGGCCGTCATCTCCGACTTCATCTACCAGGGCGCCAGC
CTGCACAACCAGACAGACCGCACGGGCGAGACCGCCTTGCACCTGGCCGCCCGCTACTCA
CGCTCTGATGCCGCCAAGCGCCTGCTGGAGGCCAGCGCAGATGCCAACATCCAGGACAAC
ATGGGCCGCACCCCGCTGCATGCGGCTGTGTCTGCCGACGCACAAGGTGTCTTCCAGATC
CTGATCCGGAACCGAGCCACAGACCTGGATGCCCGCATGCATGATGGCACGACGCCACTG
ATCCTGGCTGCCCGCCTGGCCGTGGAGGGCATGCTGGAGGACCTCATCAACTCACACGCC
GACGTCAACGCCGTAGATGACCTGGGCAAGTCCGCCCTGCACTGGGCCGCCGCCGTGAAC
AATGTGGATGCCGCAGTTGTGCTCCTGAAGAACGGGGCTAACAAAGATATGCAGAACAAC
AGGGAGGAGACACCCCTGTTTCTGGCCGCCCGGGAGGGCAGCTACGAGACCGCCAAGGTG
CTGCTGGACCACTTTGCCAACCGGGACATCACGGATCATATGGACCGCCTGCCGCGCGAC
ATCGCACAGGAGCGCATGCATCACGACATCGTGAGGCTGCTGGACGAGTACAACCTGGTG
CGCAGCCCGCAGCTGCACGGAGCCCCGCTGGGGGGCACGCCCACCCTGTCGCCCCCGCTC
TGCTCGCCCAACGGCTACCTGGGCAGCCTCAAGCCCGGCGTGCAGGGCAAGAAGGTCCGC
AAGCCCAGCAGCAAAGGCCTGGCCTGTGGAAGCAAGGAGGCCAAGGACCTCAAGGCACGG
AGGAAGAAGTCCCAGGATGGCAAGGGCTGCCTGCTGGACAGCTCCGGCATGCTCTCGCCC
GTGGACTCCCTGGAGTCACCCCATGGCTACCTGTCAGACGTGGCCTCGCCACCACTGCTG
CCCTCCCCGTTCCAGCAGTCTCCGTCCGTGCCCCTCAACCACCTGCCTGGGATGCCCGAC
ACCCACCTGGGCATCGGGCACCTGAACGTGGCGGCCAAGCCCGAGATGGCGGCGCTGGGT
GGGGGCGGCCGGCTGGCCTTTGAGACTGGCCCACCTCGTCTCTCCCACCTGCCTGTGGCC
TCTGGCACCAGCACCGTCCTGGGCTCCAGCAGCGGAGGGGCCCTGAATTTCACTGTGGGC
GGGTCCACCAGTTTGAATGGTCAATGCGAGTGGCTGTCCCGGCTGCAGAGCGGCATGGTG
CCGAACCAATACAACCCTCTGCGGGGGAGTGTGGCACCAGGCCCCCTGAGCACACAGGCC
CCCTCCCTGCAGCATGGCATGGTAGGCCCGCTGCACAGTAGCCTTGCTGCCAGCGCCCTG
TCCCAGATGATGAGCTACCAGGGCCTGCCCAGCACCCGGCTGGCCACCCAGCCTCACCTG
GTGCAGACCCAGCAGGTGCAGCCACAAAACTTACAGATGCAGCAGCAGAACCTGCAGCCA
GCAAACATCCAGCAGCAGCAAAGCCTGCAGCCGCCACCACCACCACCACAGCCGCACCTT
GGCGTGAGCTCAGCAGCCAGCGGCCACCTGGGCCGGAGCTTCCTGAGTGGAGAGCCGAGC
CAGGCAGACGTGCAGCCACTGGGCCCCAGCAGCCTGGCGGTGCACACTATTCTGCCCCAG
GAGAGCCCCGCCCTGCCCACGTCGCTGCCATCCTCGCTGGTCCCACCCGTGACCGCAGCC
CAGTTCCTGACGCCCCCCTCGCAGCACAGCTACTCCTCGCCTGTGGACAACACCCCCAGC
CACCAGCTACAGGTGCCTGAGCACCCCTTCCTCACCCCGTCCCCTGAGTCCCCTGACCAG
TGGTCCAGCTCGTCCCCGCATTCCAACGTCTCCGACTGGTCCGAGGGCGTCTCCAGCCCT
CCCACCAGCATGCAGTCCCAGATCGCCCGCATTCCGGAGGCCTTCAAGTAAACGGCGCGC
CCCACGAGACCCCGGCTTCCTTTCCCAAGCCTTCGGGCGTCTGTGTGCGCTCTGTGGATG
CCAGGGCCGACCAGAGGAGCCTTTTTAAAACACATGTTTTTATACAAAATAAGAACAAGG
ATTTTAATTTTTTTTAGTATTTATTTATGTACTTTTATTTTACACAGAAACACTGCCTTT
TTATTTATATGTACTGTTTTATCTGGCCCCAGGTAGAAACTTTTATCTATTCTGAGAAAA
CAAGCAAGTTCTGAGAGCCAGGGTTTTCCTACGTAGGATGAAAAGATTCTTCTGTGTTTA
TAAAATATAAACAAAGATTCATGATTTATAAATGCCATTTATTTATTGATTCCTTTTTTC
AAAATCCAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_017617 unedited
GGCGGCACAGACTTCATGCCGCCGCTCCTGGCGCCCCTGCTCTGCCTGGCGCTGCTGCCC
GCGCTCGCCGCACGAGGCCCGCGATGCTCCCAGCCCGGTGAGACCTGCCTGAATGGCGGG
AAGTGTGAAGCGGCCAATGGCACGGAGGCCTGCGTCTGTGGCGGGGCCTTCGTGGGCCCG
CGATGCCAGGACCCCAACCCGTGCCTCAGCACCCCCTGCAAGAACGCCGGGACATGCCAC
GTGGTGGACCGCAGAGGCGTGGCAGACTATGCCTGCAGCTGTGCCCTGGGCTTCTCTGGG
CCCCTCTGCCTGACACCCCTGGACAATGCCTGCCTCACCAACCCCTGCCGCAACGGGGGC
ACCTGCGACCTGCTCACGCTGACGGAGTACAAGTGCCGCTGCCCGCCCGGCTGGTCAGGG
AAATCGTGCCAGCAGGCTGACCCGTGCGCCTCCAACCCCTGCGCCAACGGTGGCCAGTGC
CTGCCCTTCGAGGCCTCCTACATCTGCCACTGCCCACCCAGCTTCCATGGCCCCACCTGC
CGGCAGGATGTCAACGAGTGTGGCCAGAAGCCCGGGCTTTGCCGCCACGGAGGCACCTGC
CACAACGAGGTCGGCTCCTACCGCTGCGTCTGCCGCGCCACCCACACTGGCCCCAACTGC
GAGCGGCCCTACGTGCCCTGCAGCCCCTCGCCCTGCCAGAACGGGGGCACCTGCCGCCCC
ACGGGCGACGTCACCCACGAGTGTGCCTGCCTGCCAGGCTTCACCGGCCAGAACTGTGGA
GAAAATATT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_017617 unedited
TGCCCATTGGAGATGAGCACTTGCCAGTTCCAGCCAGAACACTGGGGCAGGGGTACACAG
GGAATGCCACCCGGTTATCTGTTCAGTAAAAGCTATGACCGCGGACGTAATCTAAAGTCA
AGTTTTTTTTTTTTTTTTTTGGATTTTGAAAAAAGGTAATCAATAAATAAATGGCATTTA
TAAATCATGAATCTTTGTTTATATTTTATAAACACAGAAGAATCTTTTCATCCTACGTAA
GAAAACCCTGGCTCTCAGAACTTGCTTGTTTTCTCATAATAGATAAAAGTTTCTACCTGG
GGCCAGATAAAACAGTTCATATAAATAAAAAGGCAGTGTTTCTGTGTAAAATAAAAGTAC
CTAAATAAATACTAAAAAAAATTAAAATCCTTGTTCTTATTTTGTATAAAAACATGTGTT
TTAAAAAGGCTCCTCTGGTCCGCCCTGGCATCCACAGAGCGCACACAGACGCCCGAACGC
TTGTGAAAGGAAGCCGGGGTCTCGTGAGGCGCGCCGTATACTTGAATGCCTCCGGAATGC
GGGCGATCTGGGACTGCATGCTGGTGGGAGGGCTGGAGACCCCCTCCGACCAGTCCGAGA
CCTTGGAATATCGGTGACTACCTGGACCACTGGTCACGGGACTCAAGGGACCGGGTGAAG
AAAGGGGTGCTTAGGCAACCTGTATCTGGTGGCTGGGGGTGTTGTCAAAAAGCCAGGAAT
AACTGTGCTGCCAGGGGGGCGTCAAGAACTGGGCTGTCATCACGGTGGGAACCACCGAGG
TTGGAACTACGAAGGCCGGGCGGGGCTCTTCTGGGGGCAAATAATGTTGCCCCGCCAGGT
TCTGGGGGCCCAATGCTTAACCTTTTGCCTGGGTTTGGATTTCTCCATTAAGAAACTCTC
GGCCCCAGGGGGGCACCT
Tag Tag Free
ACCN NM_017617
ORF Size 7671 bp
Insert Size 8100
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_017617.2, NP_060087
RefSeq Size 9312
Locus ID 4851
Cytogenetics 9q34.3
Domains NL, EGF_CA, ANK, EGF, EGF
Protein Families Stem cell relevant signaling - DSL/Notch pathway, ES Cell Differentiation/IPS, Adult stem cells, Cancer stem cells, Druggable Genome
Protein Pathways Dorso-ventral axis formation, Notch signaling pathway, Prion diseases
Gene Summary This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor plays a role in the development of numerous cell and tissue types. Mutations in this gene are associated with aortic valve disease, Adams-Oliver syndrome, T-cell acute lymphoblastic leukemia, chronic lymphocytic leukemia, and head and neck squamous cell carcinoma. [provided by RefSeq, Jan 2016].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations