Protein Kinase A regulatory subunit I alpha (PRKAR1A) (NM_212472) Human Untagged Clone

SKU
SC308633
PRKAR1A (untagged)-Human protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1) (PRKAR1A), transcript variant 3
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Protein Kinase A regulatory subunit I alpha
Synonyms ACRDYS1; ADOHR; CAR; CNC; CNC1; PKR1; PPNAD1; PRKAR1; TSE1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_212472 edited
ATGGAGTCTGGCAGTACCGCCGCCAGTGAGGAGGCACGCAGCCTTCGAGAATGTGAGCTC
TACGTCCAGAAGCATAACATTCAAGCGCTGCTCAAAGATTCTATTGTGCAGTTGTGCACT
GCTCGACCTGAGAGACCCATGGCATTCCTCAGGGAATACTTTGAGAGGTTGGAGAAGGAG
GAGGCAAAACAGATTCAGAATCTGCAGAAAGCAGGCACTCGTACAGACTCAAGGGAGGAT
GAGATTTCTCCTCCTCCACCCAACCCAGTGGTTAAAGGTAGGAGGCGACGAGGTGCTATC
AGCGCTGAGGTCTACACGGAGGAAGATGCGGCATCCTATGTTAGAAAGGTTATACCAAAA
GATTACAAGACAATGGCCGCTTTAGCCAAAGCCATTGAAAAGAATGTGCTGTTTTCACAT
CTTGATGATAATGAGAGAAGTGATATTTTTGATGCCATGTTTTCGGTCTCCTTTATCGCA
GGAGAGACTGTGATTCAGCAAGGTGATGAAGGGGATAACTTCTATGTGATTGATCAAGGA
GAGACGGATGTCTATGTTAACAATGAATGGGCAACCAGTGTTGGGGAAGGAGGGAGCTTT
GGAGAACTTGCTTTGATTTATGGAACACCGAGAGCAGCCACTGTCAAAGCAAAGACAAAT
GTGAAATTGTGGGGCATCGACCGAGACAGCTATAGAAGAATCCTCATGGGAAGCACACTG
AGAAAGCGGAAGATGTATGAGGAATTCCTTAGTAAAGTCTCTATTTTAGAGTCTCTGGAC
AAGTGGGAACGTCTTACGGTAGCTGATGCATTGGAACCAGTGCAGTTTGAAGATGGGCAG
AAGATTGTGGTGCAGGGAGAACCAGGGGATGAGTTCTTCATTATTTTAGAGGGGTCAGCT
GCTGTGCTACAACGTCGGTCAGAAAATGAAGAGTTTGTTGAAGTGGGAAGATTGGGGCCT
TCTGATTATTTTGGTGAAATTGCACTACTGATGAATCGTCCTCGTGCTGCCACAGTTGTT
GCTCGTGGCCCCTTGAAGTGCGTTAAGCTGGACCGACCTAGATTTGAACGTGTTCTTGGC
CCATGCTCAGACATCCTCAAACGAAACATCCAGCAGTACAACAGTTTTGTGTCACTGTCT
GTCTGA
Restriction Sites NotI-NotI
ACCN NM_212472
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_212472.1.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_212472.1, NP_997637.1
RefSeq Size 3657 bp
RefSeq ORF 1146 bp
Locus ID 5573
UniProt ID P10644
Cytogenetics 17q24.2
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Apoptosis, Insulin signaling pathway
Summary cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. This gene encodes one of the regulatory subunits. This protein was found to be a tissue-specific extinguisher that down-regulates the expression of seven liver genes in hepatoma x fibroblast hybrids. Mutations in this gene cause Carney complex (CNC). This gene can fuse to the RET protooncogene by gene rearrangement and form the thyroid tumor-specific chimeric oncogene known as PTC2. A nonconventional nuclear localization sequence (NLS) has been found for this protein which suggests a role in DNA replication via the protein serving as a nuclear transport protein for the second subunit of the Replication Factor C (RFC40). Several alternatively spliced transcript variants encoding two different isoforms have been observed. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (3) contains an alternate exon in place of the first 5' UTR exon compared to variant 2. Variants 1, 2, 3, 4, and 6 all encode the same isoform (a).
Write Your Own Review
You're reviewing:Protein Kinase A regulatory subunit I alpha (PRKAR1A) (NM_212472) Human Untagged Clone
Your Rating
SKU Description Size Price
RC212810 PRKAR1A (Myc-DDK-tagged)-Human protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1) (PRKAR1A), transcript variant 3 10 ug
$457.00
RC212810L3 Lenti ORF clone of Human protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1) (PRKAR1A), transcript variant 3, Myc-DDK-tagged 10 ug
$757.00
RC212810L4 Lenti ORF clone of Human protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1) (PRKAR1A), transcript variant 3, mGFP tagged 10 ug
$757.00
RG212810 PRKAR1A (tGFP-tagged) - Human protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1) (PRKAR1A), transcript variant 3 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.