C1QTNF8 (NM_207419) Human Untagged Clone

SKU
SC308530
C1QTNF8 (untagged)-Human C1q and tumor necrosis factor related protein 8 (C1QTNF8)
$300.00
2 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol C1QTNF8
Synonyms CTRP8; UNQ5829
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_207419 edited
ATGGCAGCCCCCGCCCTGCTGCTCCTAGCACTGCTGCTGCCCGTGGGGGCCTGGCCCGGG
CTGCCCAGGAGGCCCTGTGTGCACTGCTGCCGCCCGGCCTGGCCCCCTGGACCCTATGCC
CGGGTGAGTGACAGGGACCTGTGGAGGGGGGACCTGTGGAGGGGGCTGCCTCGAGTACGG
CCCACTATAGACATCGAAATCCTCAAAGGTGAGAAGGGTGAGGCCGGCGTCCGAGGTCGG
GCCGGCAGGAGCGGGAAAGAGGGGCCGCCAGGCGCCCGGGGCCTGCAGGGCCGCAGAGGC
CAGAAGGGGCAGGTGGGGCCGCCGGGCGCCGCGTGCCGACGTGCCTACGCCGCCTTCTCC
GTGGGCCGGCGCGAGGGCCTGCACAGCTCCGACCACTTCCAGGCGGTGCCCTTCGACACG
GAGCTGGTGAACCTGGACGGCGCCTTCGACCTGGCCGCGGGCCGCTTCCTCTGCACGGTG
CCCGGCGTCTACTTCCTCAGCCTCAACGTGCACACCTGGAACTACAAGGAGACCTACCTG
CACATCATGCTGAACCGGCGGCCCGCGGCCGTGCTCTACGCGCAGCCCAGCGAGCGCAGC
GTCATGCAGGCCCAGAGCCTGATGCTGCTGCTGGCGGCGGGCGACGCCGTCTGGGTGCGC
ATGTTCCAGCGCGACCGGGACAACGCCATCTACGGCGAGCACGGAGACCTCTACATCACC
TTCAGCGGCCACCTGGTCAAGCCGGCCGCCGAGCTGTAGTCTAGA
Restriction Sites Please inquire
ACCN NM_207419
Insert Size 800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_207419.2, NP_997302.2
RefSeq Size 2974 bp
RefSeq ORF 759 bp
Locus ID 390664
UniProt ID P60827
Cytogenetics 16p13.3
Protein Families Secreted Protein
Summary May play a role as ligand of RXFP1.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:C1QTNF8 (NM_207419) Human Untagged Clone
Your Rating
SKU Description Size Price
RC211649 C1QTNF8 (Myc-DDK-tagged)-Human C1q and tumor necrosis factor related protein 8 (C1QTNF8) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
RC211649L3 Lenti ORF clone of Human C1q and tumor necrosis factor related protein 8 (C1QTNF8), Myc-DDK-tagged 10 ug
$600.00
RC211649L4 Lenti ORF clone of Human C1q and tumor necrosis factor related protein 8 (C1QTNF8), mGFP tagged 10 ug
$600.00
RG211649 C1QTNF8 (tGFP-tagged) - Human C1q and tumor necrosis factor related protein 8 (C1QTNF8) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.