C17orf87 (SCIMP) (NM_207103) Human Untagged Clone

SKU
SC308382
SCIMP (untagged)-Human chromosome 17 open reading frame 87 (C17orf87)
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol C17orf87
Synonyms C17orf87; UNQ5783
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_207103 edited
TCCAGCCACTGCTGTCTCCTTAGCTGCTCACATATGGATACTTTCACAGTTCAGGATTCC
ACTGCAATGAGCTGGTGGAGGAATAATTTCTGGATCATCTTAGCTGTGGCCATCATTGTT
GTCTCTGTGGGCCTGGGCCTCATCCTGTACTGTGTCTGTAAGTGGCAGCTTAGACGAGGC
AAGAAATGGGAAATTGCCAAGCCCCTGAAACACAAGCAAGTAGATGAAGAAAAGATGTAT
GAGAATGTTCTTAATGAGTCGCCAGTTCAATTACCGCCTCTGCCACCGAGGAATTGGCCT
TCTCTAGAAGACTCTTCCCCACAGGAAGCCCCAAGTCAGCCGCCCGCTACATACTCACTG
GTAAATAAAGTTAAAAATAAGAAGACTGTTTCCATCCCAAGCTACATTGAGCCTGAAGAT
GACTATGACGATGTTGAAATCCCTGCAAATACTGAAAAAGCATCATTTTGAAACAGCCAT
TTCTTCTTTTTGGCAAAACTGAAGAGGGTTCACACAACTTATTTTAAAACAATCAAGAAT
GGTTGAACTTCAGTAGGTCTCTGGGCCCTGAAAGCCAGTGGTGATTTTATGAAGCTCTAT
AAGATAAAGCACTTCCCAAACCTTAGATGAAGACACCCCTGCGATCGGATGACTGCAGCC
AGAGGA
Restriction Sites Please inquire
ACCN NM_207103
Insert Size 700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_207103.1.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_207103.1, NP_996986.1
RefSeq Size 925 bp
RefSeq ORF 438 bp
Locus ID 388325
UniProt ID Q6UWF3
Cytogenetics 17p13.2
Protein Families Transmembrane
Summary This gene encodes a transmembrane adaptor protein that is expressed in antigen-presenting cells and is localized in the immunologic synapse. The encoded protein is involved in major histocompatibility complex class II signal transduction and immune synapse formation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2012]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:C17orf87 (SCIMP) (NM_207103) Human Untagged Clone
Your Rating
SKU Description Size Price
RC213295 SCIMP (Myc-DDK-tagged)-Human chromosome 17 open reading frame 87 (C17orf87) 10 ug
$150.00
RC213295L1 Lenti ORF clone of Human chromosome 17 open reading frame 87 (C17orf87), Myc-DDK-tagged 10 ug
$450.00
RC213295L2 Lenti ORF clone of Human chromosome 17 open reading frame 87 (C17orf87), mGFP tagged 10 ug
$450.00
RC213295L3 Lenti ORF clone of Human chromosome 17 open reading frame 87 (C17orf87), Myc-DDK-tagged 10 ug
$450.00
RC213295L4 Lenti ORF clone of Human chromosome 17 open reading frame 87 (C17orf87), mGFP tagged 10 ug
$450.00
RG213295 SCIMP (tGFP-tagged) - Human chromosome 17 open reading frame 87 (C17orf87) 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.