NDRG2 (NM_201540) Human Untagged Clone

SKU
SC308046
NDRG2 (untagged)-Human NDRG family member 2 (NDRG2), transcript variant 7
$503.00
4 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NDRG2
Synonyms SYLD
Vector pCMV6 series
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_201540, the custom clone sequence may differ by one or more nucleotides
ATGGCGGAGCTGCAGGAGGTGCAGATCACAGAGGAGAAGCCACTGTTGCCAGGACAGACG
CCTGAGGCGGCCAAGGAGGCTGAGTTAGCTGCCCGAATCCTCCTGGACCAGGGACAGACT
CACTCTGTGGAGACACCATACGGCTCTGTCACTTTCACTGTCTATGGCACCCCCAAACCC
AAACGCCCAGCGATCCTTACCTACCACGATGTGGGACTCAACTATAAATCTTGCTTCCAG
CCACTGTTTCAGTTCGAGGACATGCAGGAAATCATTCAGAACTTTGTGCGGGTTCATGTG
GATGCCCCTGGAATGGAAGAGGGAGCCCCTGTGTTCCCTTTGGGATATCAGTACCCATCT
CTGGACCAGCTTGCAGACATGATCCCTTGCGTCCTGCAGTACCTAAATTTCTCTACAATA
ATTGGAGTTGGTGTTGGAGCTGGAGCCTACATCCTGGCGAGATATGCTCTTAACCACCCG
GACACTGTTGAAGGTCTTGTCCTCATCAACATTGATCCCAATGCCAAGGGTTGGATGGAT
TGGGCAGCCCACAAGCTAACAGGCCTCACCTCTTCCATTCCGGAGATGATCCTTGGACAT
CTTTTCAGCCAGGAAGAGCTCTCTGGAAATTCTGAGTTGATACAAAAGTACAGAAATATC
ATTACACATGCACCCAACCTGGATAACATTGAATTGTACTGGAACAGCTACAACAACCGC
CGAGACCTGAACTTTGAGCGTGGAGGTGATATCACCCTCAGGTGTCCTGTGATGCTGGTG
GTAGGAGACCAAGCACCTCATGAAGATGCAGTGGTGGAATGTAACTCAAAACTGGACCCC
ACCCAGACCTCGTTCCTCAAGATGGCTGACTCCGGAGGTCAGCCCCAGCTGACTCAGCCA
GGCAAGCTGACCGAGGCCTTCAAGTACTTCCTGCAAGGCATGGGCTACATGGCCTCATCC
TGCATGACTCGCCTGTCCCGGTCTCGTACAGCCTCTCTGACCAGTGCAGCATCCGTTGAT
GGCAACCGGTCCCGCTCTCGCACCCTGTCCCAGAGCAGCGAGTCTGGAACTCTTTCTTCG
GGGCCCCCGGGGCACACCATGGAGGTCTCCTGTTGA
Restriction Sites Please inquire
ACCN NM_201540
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_201540.1, NP_963834.1
RefSeq Size 2119 bp
RefSeq ORF 1116 bp
Locus ID 57447
UniProt ID Q9UN36
Cytogenetics 14q11.2
Summary This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein that may play a role in neurite outgrowth. This gene may be involved in glioblastoma carcinogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2017]
Transcript Variant: This variant (7) differs in the 5' UTR compared to variant 1. Variants 1, 4, 6, 7 and 15 encode the same isoform (a).
Write Your Own Review
You're reviewing:NDRG2 (NM_201540) Human Untagged Clone
Your Rating
SKU Description Size Price
RC214708 NDRG2 (Myc-DDK-tagged)-Human NDRG family member 2 (NDRG2), transcript variant 7 10 ug
$457.00
RC214708L3 Lenti-ORF clone of NDRG2 (Myc-DDK-tagged)-Human NDRG family member 2 (NDRG2), transcript variant 7 10 ug
$757.00
RC214708L4 Lenti-ORF clone of NDRG2 (mGFP-tagged)-Human NDRG family member 2 (NDRG2), transcript variant 7 10 ug
$757.00
RG214708 NDRG2 (tGFP-tagged) - Human NDRG family member 2 (NDRG2), transcript variant 7 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.