INDOL1 (IDO2) (NM_194294) Human Untagged Clone

CAT#: SC307585

IDO2 (untagged)-Human indoleamine 2,3-dioxygenase 2 (IDO2)


  "NM_194294" in other vectors (7)

Reconstitution Protocol

USD 450.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
IDO2 mouse monoclonal antibody, clone OTI1A4 (formerly 1A4)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "INDOL1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol INDOL1
Synonyms INDOL1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_194294 edited
ATGTTGCATTTTCATTATTATGATACTTCAAACAAAATAATGGAGCCCCACAGACCGAAT
GTGAAGACAGCAGTGCCATTGTCTTTGGAAAGCTATCACATATCTGAAGAGTATGGCTTT
CTTCTTCCAGATTCTCTGAAAGAACTTCCAGATCATTATAGGCCTTGGATGGAAATTGCC
AACAAACTTCCTCAATTGATTGATGCTCACCAGCTTCAAGCTCATGTGGACAAGATGCCC
CTGCTGAGCTGCCAGTTCCTGAAGGGTCACCGGGAGCAGCGCCTGGCCCACCTGGTCCTG
AGCTTCCTCACCATGGGTTATGTCTGGCAGGAAGGAGAGGCGCAGCCTGCAGAGGTCCTG
CCAAGGAATCTTGCCCTTCCATTTGTCGAAGTCTCCAGGAACTTGGGGCTCCCTCCTATC
CTGGTCCACTCAGACTTGGTGCTGACGAACTGGACCAAAAAAGATCCAGACGGATTCCTG
GAAATTGGGAACCTGGAGACCATCATCTCATTTCCTGGGGGAGAGAGCCTGCATGGTTTT
ATACTGGTGACTGCTTTGGTAGAGAAAGAAGCAGTGCCTGGGATAAAGGCTCTTGTTCAG
GCCACGAATGCTATCTTGCAGCCCAACCAGGAGGCCCTGCTCCAAGCCCTGCAGCGACTG
AGACTGTCTATTCAGGACATCACCAAAACCTTAGGACAGATGCATGATTATGTAGATCCA
GACATATTTTATGCAGGCATCCGGATCTTTCTCTCTGGATGGAAAGACAACCCAGCAATG
CCTGCAGGGCTGATGTATGAAGGAGTTTCCCAAGAGCCCCTGAAATACTCCGGCGGGAGT
GCAGCTCAGAGCACAGTGCTTCATGCCTTTGATGAGTTCTTAGGCATTCGTCATAGCAAG
GAAAGTGGTGACTTTCTGTACAGAATGAGGGATTACATGCCTCCTTCCCATAAGGCCTTC
ATAGAAGACATCCACTCAGCACCTTCCCTGAGGGACTACATCCTGTCATCTGGACAGGAC
CACTTGCTGACAGCTTATAACCAGTGTGTGCAGGCCCTGGCAGAGCTGCGGAGCTATCAC
ATCACCATGGTCACCAAATACCTCATCACAGCTGCAGCCAAGGCAAAGCATGGGAAGCCA
AACCATCTCCCAGGGCCTCCTCAGGCTTTAAAAGACAGGGGCACAGGTGGAACCGCAGTT
ATGAGCTTTCTTAAGAGTGTCAGGGATAAGACCTTGGAGTCAATCCTTCACCCACGTGGT
TAG
Restriction Sites Please inquire     
ACCN NM_194294
Insert Size 1300 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_194294.1, NP_919270.1
RefSeq Size 3923 bp
RefSeq ORF 519 bp
Locus ID 169355
UniProt ID Q6ZQW0
Cytogenetics 8p11.21
Protein Pathways Metabolic pathways, Tryptophan metabolism
Gene Summary Along with the enzymes encoded by the INDO (MIM 147435) and TDO2 (MIM 191070) genes, the enzyme encoded by the INDOL1 gene metabolizes tryptophan in the kynurenine pathway (Ball et al., 2007 [PubMed 17499941]).[supplied by OMIM, Feb 2011]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.