NPM2 (NM_182795) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | NPM2 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_182795 edited
GAGGGGATGAGGTTGCGCTGCGCTCCGGGAGCGCCGATGGCGTGACTGGCCCCGCGCGGA GCAGCGACACTGCCCGGCCAGCCCGCTTCTCTGCCCGGAGCCATGAATCTCAGTAGCGCC AGTAGCACGGAGGAAAAGGCAGTGACGACCGTGCTCTGGGGCTGCGAGCTCAGTCAGGAG AGGCGGACTTGGACCTTCAGACCCCAGCTGGAGGGGAAGCAGAGCTGCAGGCTGTTGCTT CATACGATTTGCTTGGGGGAGAAAGCCAAAGAGGAGATGCATCGCGTGGAGATCCTGCCC CCAGCAAACCAGGAGGACAAGAAGATGCAGCCGGTCACCATTGCCTCACTCCAGGCCTCA GTCCTCCCCATGGTCTCCATGGTAGGAGTGCAGCTTTCTCCCCCAGTTACTTTCCAGCTC CGGGCTGGCTCAGGACCCGTGTTCCTCAGTGGCCAGGAACGTTATGAAGCATCAGACCTA ACCTGGGAGGAGGAGGAGGAAGAAGAAGGGGAGGAGGAGGAAGAGGAAGAGGAAGATGAT GAGGATGAGGATGCAGATATATCTCTGGAGGAGCAAAGCCCTGTCAAACAAGTCAAAAGG CTGGTGCCCCAGAAGCAGGCGAGCGTGGCTAAGAAAAAAAAGCTGGAAAAAGAAGAAGAG GAAATAAGAGCCAGCGTTAGAGACAAGAGCCCTGTGAAAAAGGCCAAAGCCACAGCCAGA GCCAAGAAGCCAGGATTCAAGAAATGAGGAGCCACGCCTTGGGGGGCACGGTGCAAAGTG GGCCTTCCCTGGGCTGTGCTGCAGGCACAGGGTGCCCCTGTCCAGCCCCTCCACCTGTGT CTGAATGCAACAGGGGTGTTGCGGGGGCAACATGAGAGCCCCTCACCCCCAACTCTCCAC TTTCAGGAGGCCCCCAGTGAAGAGCCCCACCTCGGGGTCACAATAAAGTTGCCTGGTCAG G |
Restriction Sites | Please inquire |
ACCN | NM_182795 |
Insert Size | 1000 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM182795.1. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_182795.1, NP_877724.1 |
RefSeq Size | 1118 bp |
RefSeq ORF | 645 bp |
Locus ID | 10361 |
UniProt ID | Q86SE8 |
Cytogenetics | 8p21.3 |
Summary | Core histones chaperone involved in chromatin reprogramming, specially during fertilization and early embryonic development. Probably involved in sperm DNA decondensation during fertilization.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longer isoform (1). Both variants 1 and 2 encode the same isoform (1). |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC220110 | NPM2 (Myc-DDK-tagged)-Human nucleophosmin/nucleoplasmin 2 (NPM2) | 10 ug |
$300.00
|
|
RC220110L3 | Lenti ORF clone of Human nucleophosmin/nucleoplasmin 2 (NPM2), Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC220110L4 | Lenti ORF clone of Human nucleophosmin/nucleoplasmin 2 (NPM2), mGFP tagged | 10 ug |
$600.00
|
|
RG220110 | NPM2 (tGFP-tagged) - Human nucleophosmin/nucleoplasmin 2 (NPM2) | 10 ug |
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.