AMELX (NM_182680) Human Untagged Clone

CAT#: SC307480

AMELX (untagged)-Human amelogenin, X-linked (AMELX), transcript variant 3


  "NM_182680" in other vectors (6)

Reconstitution Protocol

USD 480.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "AMELX"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol AMELX
Synonyms AI1E; AIH1; ALGN; AMG; AMGL; AMGX
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC307480 representing NM_182680.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGACCTGGATTTTATTTGCCTGCCTCCTGGGAGCAGCTTTTGCCATGCCTCTACCACCTCATCCT
GGGCACCCTGGTTATATCAACTTCAGCTATGAGAACTCACATTCTCAGGCTATCAATGTTGACAGGACT
GCATTAGTGCTTACCCCTTTGAAGTGGTACCAGAGCATAAGGCCACCGTACCCTTCCTATGGTTACGAG
CCCATGGGTGGATGGCTGCACCACCAAATCATCCCCGTGCTGTCCCAACAGCACCCCCCGACTCACACC
CTGCAGCCTCATCACCACATCCCAGTGGTGCCAGCTCAGCAGCCCGTGATCCCCCAGCAACCAATGATG
CCCGTTCCTGGCCAACACTCCATGACTCCAATCCAACACCACCAGCCAAACCTCCCTCCGCCCGCCCAG
CAGCCCTACCAGCCCCAGCCTGTTCAGCCACAGCCTCACCAGCCCATGCAGCCCCAGCCACCTGTGCAC
CCCATGCAGCCCCTGCCGCCACAGCCACCTCTGCCTCCGATGTTCCCCATGCAGCCCCTGCCTCCCATG
CTTCCTGATCTGACTCTGGAAGCTTGGCCATCAACAGACAAGACCAAGCGGGAGGAAGTGGATTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_182680
Insert Size 618 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_182680.1
RefSeq Size 835 bp
RefSeq ORF 618 bp
Locus ID 265
UniProt ID Q99217
Cytogenetics Xp22.2
Protein Families Druggable Genome, Secreted Protein, Transmembrane
MW 23.1 kDa
Gene Summary This gene encodes a member of the amelogenin family of extracellular matrix proteins. Amelogenins are involved in biomineralization during tooth enamel development. Mutations in this gene cause X-linked amelogenesis imperfecta. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) encodes the longest isoform (3).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.