GEM (NM_181702) Human Untagged Clone

CAT#: SC307348

GEM (untagged)-Human GTP binding protein overexpressed in skeletal muscle (GEM), transcript variant 2


  "NM_181702" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-GEM Antibody
    • 100 ul

USD 485.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GEM
Synonyms KIR
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC307348 representing NM_181702.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACTCTGAATAATGTCACCATGCGCCAGGGCACTGTGGGCATGCAGCCACAGCAGCAGCGCTGGAGC
ATCCCAGCTGATGGCAGGCATCTGATGGTCCAGAAAGAGCCCCACCAGTACAGCCACCGCAACCGCCAT
TCTGCTACCCCTGAGGACCACTGCCGCCGAAGCTGGTCCTCTGACTCCACAGACTCAGTCATCTCCTCT
GAGTCAGGGAACACCTACTACCGAGTGGTGCTCATAGGGGAGCAGGGGGTGGGCAAGTCCACTCTGGCC
AACATCTTTGCAGGTGTGCATGACAGCATGGACAGCGACTGCGAGGTGCTGGGAGAAGATACATATGAA
CGAACCCTGATGGTTGATGGGGAAAGTGCAACGATTATACTCCTGGATATGTGGGAAAATAAGGGGGAA
AATGAATGGCTCCATGACCACTGCATGCAGGTCGGGGACGCATACCTGATTGTCTACTCAATCACAGAC
CGAGCGAGCTTCGAGAAGGCATCTGAGCTGCGAATCCAGCTCCGCAGGGCCCGGCAGACAGAGGACATT
CCCATAATTTTGGTTGGCAACAAAAGTGACTTAGTGCGGTGCCGAGAAGTGTCTGTATCAGAAGGGAGA
GCCTGTGCAGTGGTGTTTGACTGCAAGTTCATCGAGACCTCTGCAGCTGTCCAGCACAACGTGAAGGAG
CTGTTTGAGGGCATTGTGCGACAGGTGCGCCTTCGGCGGGACAGCAAGGAGAAGAATGAACGGCGGCTG
GCCTACCAGAAAAGGAAGGAGAGCATGCCCAGGAAAGCCAGGCGCTTCTGGGGCAAGATCGTGGCCAAA
AACAACAAGAATATGGCCTTCAAGCTCAAGTCCAAATCCTGCCATGACCTCTCTGTACTCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_181702
Insert Size 891 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_181702.2
RefSeq Size 2080 bp
RefSeq ORF 891 bp
Locus ID 2669
UniProt ID P55040
Cytogenetics 8q22.1
Protein Families Druggable Genome
MW 33.9 kDa
Gene Summary The protein encoded by this gene belongs to the RAD/GEM family of GTP-binding proteins. It is associated with the inner face of the plasma membrane and could play a role as a regulatory protein in receptor-mediated signal transduction. Alternative splicing occurs at this locus and two transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.