CTAG2 (NM_172377) Human Untagged Clone

SKU SC306767

CTAG2 (untagged)-Human cancer/testis antigen 2 (CTAG2), transcript variant 1

Product Data

• Type: Human Untagged Clone
• Target Symbol: CTAG2
• Synonyms: CAMEL; CT2; CT6.2; CT6.2a; CT6.2b; ESO2; LAGE-1; LAGE2B
• Vector: pCMV6-XL6
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_172377 edited; GGCCCTGACCTTCTCTCTGAGAGCCGGGCAGAGGCTCCGGAGCCATGCAGGCCGAAGGCC; GGGGCACAGGGGGTTCGACGGGCGATGCTGATGGCCCAGGAGGCCCTGGCATTCCTGATG; GCCCAGGGGGCAATGCTGGCGGCCCAGGAGAGGCGGGTGCCACGGGCGGCAGAGGTCCCC; GGGGCGCAGGGGCAGCAAGGGCCTCGGGGCCGAGAGGAGGCGCCCCGCGGGGTCCGCATG; GCGGTGCCGCTTCTGCGCAGGATGGAAGGTGCCCCTGCGGGGCCAGGAGGCCGGACAGCC; GCCTGCTTGAGTTGCACATCACGATGCCTTTCTCGTCGCCCATGGAAGCGGAGCTGGTCC; GCAGGATCCTGTCCCGGGATGCCGCACCGCTCCCCCGACCAGGGGCGGTTCTGAAGGACT; TCACCGTGTCCGGCAACCTACTGTTTATCCGACTGACTGCTGCAGACCACCGCCAACTGC; AGCTCTCCATCAGCTCCTGTCTCCAGCAGCTTTCCCTGTTGATGTGGATCACGCAGTGCT; TTCTGCCCGTGTTTTTGGCTCAGGCTCCCTCAGGGCAGAGGCGCTAAGCCCAGCCTGGCG; CCCCTTCCTAGGTCATGCCTCCTCCCCTAGGGAATGGTCCCAGCACGAGTGGCCAGTTCA; TTGTGGGGGCCTGATTGTTTGTCGCTGGAGGAGGACGGCTTACATG;
• Restriction Sites: Please inquire
• ACCN: NM_172377
• Insert Size: 700 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to contain 2 SNPs compared with reference sequence NM_172377.2.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_172377.2, NP_758965.1
• RefSeq Size: 766 bp
• RefSeq ORF: 543 bp
• Locus ID: 30848
• UniProt ID: O75638
• Cytogenetics: Xq28
• Summary: This gene encodes an autoimmunogenic tumor antigen that belongs to the ESO/LAGE family of cancer-testis antigens. This protein is expressed in a wide array of cancers including melanoma, breast cancer, bladder cancer and prostate cancer. This protein is also expressed in normal testis tissue. An alternative open reading frame product of this gene has been described in PMID:10399963. This alternate protein, termed CAMEL, is a tumor antigen that is recognized by melanoma-specific cytotoxic T-lymphocytes. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]; Transcript Variant: This variant (1) encodes isoform LAGE-1a (also known as LAGE-1S).