PITX2 (NM_153426) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | PITX2 |
Synonyms | ARP1; ASGD4; Brx1; IDG2; IGDS; IGDS2; IHG2; IRID2; Otlx2; PTX2; RGS; RIEG; RIEG1; RS |
Vector | pCMV6-XL6 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_153426 edited
ATGGAGACCAACTGCCGCAAACTGGTGTCGGCGTGTGTGCAATTAGGCGTGCAGCCGGCG GCCGTTGAATGTCTCTTCTCCAAAGACTCCGAAATCAAAAAGGTCGAGTTCACGGACTCT CCTGAGAGCCGAAAAGAGGCAGCCAGCAGCAAGTTCTTCCCGCGGCAGCATCCTGGCGCC AATGAGAAAGATAAAAGCCAGCAGGGGAAGAATGAGGACGTGGGCGCCGAGGACCCGTCT AAGAAGAAGCGGCAAAGGCGGCAGCGGACTCACTTTACCAGCCAGCAGCTCCAGGAGCTG GAGGCCACTTTCCAGAGGAACCGCTACCCGGACATGTCCACACGCGAAGAAATCGCTGTG TGGACCAACCTTACGGAAGCCCGAGTCCGGGTTTGGTTCAAGAATCGTCGGGCCAAATGG AGAAAGAGGGAGCGCAACCAGCAGGCCGAGCTATGCAAGAATGGCTTCGGGCCGCAGTTC AATGGGCTCATGCAGCCCTACGACGACATGTACCCAGGCTATTCCTACAACAACTGGGCC GCCAAGGGCCTTACATCCGCCTCCCTATCCACCAAGAGCTTCCCCTTCTTCAACTCTATG AACGTCAACCCCCTGTCATCACAGAGCATGTTTTCCCCACCCAACTCTATCTCGTCCATG AGCATGTCGTCCAGCATGGTGCCCTCAGCAGTGACAGGCGTCCCGGGCTCCAGTCTCAAC AGCCTGAATAACTTGAACAACCTGAGTAGCCCGTCGCTGAATTCCGCGGTGCCGACGCCT GCCTGTCCTTACGCGCCGCCGACTCCTCCGTATGTTTATAGGGACACGTGTAACTCGAGC CTGGCCAGCCTGAGACTGAAAGCAAAGCAGCACTCCAGCTTCGGCTACGCCAGCGTGCAG AACCCGGCCTCCAACCTGAGTGCTTGCCAGTATGCAGTGGACCGGCCCGTGTGA |
Restriction Sites | Please inquire |
ACCN | NM_153426 |
Insert Size | 950 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_153426.1, NP_700475.1 |
RefSeq Size | 2250 bp |
RefSeq ORF | 954 bp |
Locus ID | 5308 |
UniProt ID | Q99697 |
Cytogenetics | 4q25 |
Protein Families | Transcription Factors |
Protein Pathways | TGF-beta signaling pathway |
Summary | This gene encodes a member of the RIEG/PITX homeobox family, which is in the bicoid class of homeodomain proteins. The encoded protein acts as a transcription factor and regulates procollagen lysyl hydroxylase gene expression. This protein plays a role in the terminal differentiation of somatotroph and lactotroph cell phenotypes, is involved in the development of the eye, tooth and abdominal organs, and acts as a transcriptional regulator involved in basal and hormone-regulated activity of prolactin. Mutations in this gene are associated with Axenfeld-Rieger syndrome, iridogoniodysgenesis syndrome, and sporadic cases of Peters anomaly. A similar protein in other vertebrates is involved in the determination of left-right asymmetry during development. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2), also known as ARP1b, encodes the predominant isoform (b). |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC213218 | PITX2 (Myc-DDK-tagged)-Human paired-like homeodomain 2 (PITX2), transcript variant 2 | 10 ug |
$300.00
|
|
RC213218L1 | Lenti ORF clone of Human paired-like homeodomain 2 (PITX2), transcript variant 2, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC213218L2 | Lenti ORF clone of Human paired-like homeodomain 2 (PITX2), transcript variant 2, mGFP tagged | 10 ug |
$600.00
|
|
RC213218L3 | Lenti ORF clone of Human paired-like homeodomain 2 (PITX2), transcript variant 2, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC213218L4 | Lenti ORF clone of Human paired-like homeodomain 2 (PITX2), transcript variant 2, mGFP tagged | 10 ug |
$600.00
|
|
RG213218 | PITX2 (tGFP-tagged) - Human paired-like homeodomain 2 (PITX2), transcript variant 2 | 10 ug |
$489.00
MSRP
$500.00
MSRP
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.